 |
| About Bioline | All Journals | Testimonials | Membership | News |
|
||||||
|
||||||
Agricultura Técnica, Vol. 64, No. 3, Jul-Sept, 2004, pp. 223-228 SELECTION OF CHILEAN WHEAT GENOTYPES CARRIERS OF THE HMW GLUTENIN ALLELE Glu-D1 x5 THROUGH POLYMERASE CHAIN REACTION Selección de genotipos chilenos de trigo portadores del alelo glutenina HMW Glu-D1 x5 mediante reacción en cadena de la ADN polimerasa Javier Zúñiga1, Paola Rathgeb1, Claudio Jobet1 y Hugo Campos2* [1] Instituto
de Investigaciones Agropecuarias, Centro Regional de Investigación Carillanca,
Casilla 58-D, Temuco, Chile. Recibido (Reenviado):
08 de enero de 2004. Code Number: at04023 ABSTRACT Baking quality is a key factor in the development of improved wheat (Triticum aestivum L.) cultivars and it is associated with a specific protein fraction known as High Molecular Weight (HMW) glutenins, although there are other proteins involved in baking quality. Current selection of wheat germplasm with improved baking quality is based on gluten and dough analyses, or the identification of HMW glutenin alleles using electrophoretic procedures. This report presents the deployment of an allele-specific Polymerase Chain Reaction (PCR) system to identify the presence of the gene encoding the Glu-D1 HMWx5 glutenin, associated with good baking quality . Primers targeting part of its promoter and its 5’ extreme were used to differentiate it from its allele Glu-D1 HMWx2. A 450 pairs of bases (pb) band was amplified in genotypes carrying the allele HMWx5, a size consistent with that expected from GenBank sequence data, whereas no amplification was observed in genotypes carrying the HMWx2 allele. The system was validated on a wide range of unrelated Chilean genotypes and allowed the rapid and unequivocal identification of genotypes possessing the HMWx5 allele with high throughput. The development of this and other systems will allow the development of more effective and focused breeding approaches in wheat. Key words: plant breeding, wheat, Triticum aestivum L., biotechnology, PCR RESUMENLa calidad panadera es un importante elemento para el desarrollo de nuevas variedades de trigo (Triticum aestivum L.) y se asocia principalmente con un conjunto de proteínas conocidas como gluteninas de elevado peso molecular (HMW), aún cuando existen otras proteínas relacionadas con la calidad panadera. Los procesos actuales de selección de genotipos con calidad panadera se basan en el contenido de gluten de la masa o la identificación de alelos codificadores de gluteninas HMW mediante electroforesis. Se reporta un método basado en la identificación, mediante la reacción en cadena de la ADN polimerasa (PCR), del alelo codificador de la glutenina HMWx5, la cual se asocia con calidad panadera. Mediante el uso de partidores apropiados se amplificó de forma específica un fragmento del promotor de este gen y parte de su extremo 5’. En aquellos genotipos portadores del gen HMWx5 se amplificó un fragmento de aproximadamente 450 pares de bases (pb) el cual es consistente con el tamaño esperado a partir de su secuencia depositada en la base de datos Genbank. Su alelo HMWx2 no amplificó producto PCR alguno. El sistema fue validado en un grupo de genotipos de trigos de diverso origen y permitió la rápida e inequívoca identificación de genotipos portadores del alelo HMWx5. El desarrollo del sistema y otros análogos permitirá el desarrollo de sistemas de mejoramiento genético de trigo más efectivos y focalizados. Palabras clave: mejoramiento genético, trigo, Triticum aestivum L., biotecnología, PCR INTRODUCTION Wheat (Triticum aestivum L.) is one of the most important cereal crops of the world, and its baking quality is an increasingly important trait since it defines the uses and marketability of wheat derived products. Although the protein fraction of wheat seed known as gluten is associated with baking quality, High Molecular Weight (HMW) glutenins are the subunits most closely associated with this trait. These proteins have conserved amino and carboxy domains with Cys residues and a repetitive hydrophobic central domain. The homologous loci Glu-A, Glu-B and Glu-D control the synthesis of HMW glutenins and are found on linkage group 1 of their respective homologous genomes in wheat. Each loci encodes two subunits of different molecular weights, x and y. These subunits present a tight genetic linkage and are frequently reported as the x+y pair. Several independent studies report the close association between the allelic pair HMWx5+y10 at the locus Glu-D1 and improved baking quality, whereas the opposite applies to the allelic pair HMWx2+y12 (Shewry et al., 1994; Shewry and Tatham, 1997). The genetic analysis of wheat is hampered by its large genome size (3.500 Mb, being 1 Mb 1.000.000 pairs of bases) and hexaploid nature (there are three genomes: A, B and D in cultivated wheat). Traditional methods to select wheat segregant lines carrying “good” baking quality alleles are based upon sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) systems or the rheological analysis of advanced breeding lines. However, according to Goldsborough et al. (1989) there are known discrepancies between derived molecular weights and their order of migration on SDS-PAGE for some HMW glutenins. Since even medium size wheat breeding programs handle over 10.000 genotypes per year, steady and cost-effective systems based on the identification of genes rather than gene products are required. Once such systems are developed and verified they can be easily upscaled and expanded, taking advantage of Polymerase Chain Reaction (PCR) procedures. Here we report the deployment of a diagnostic system for the allele Glu-D1 HMWx5, hereafter referred to as HMWx5, based upon PCR procedures. Results are discussed from a wheat breeding standpoint. MATERIALS AND METHODSExperiments were conducted in the Biotechnology Unit of the Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación Carillanca, Temuco, IX Region, Chile. Cultivars carrying the alleles HMWx2 and HMWx5, namely Chinese Spring and Dalcahue INIA, were used as control genotypes. Total endosperm protein from wheat grains was extracted and separated using SDS-PAGE according to Hewstone and Hinrichsen (1994). Genomic deoxyribonucleic acid (DNA) was extracted from young, clean leaves according to Campos and Ortega (2001). DNA quantification was conducted with a spectrophotometer (MBC 2000, Perkin Elmer, USA) and its integrity assessed on agarose gels. The following primers (5’-3’) D’Ovidio and Anderson (1994) were custom synthesized at BIOS Chile: Primer 1: GCCTAGCAACCTTCACAATC Optimized PCR conditions were 50 ng of DNA; 300 mM each dNTP (Promega, USA), 3 mM MgCl2 (Sigma, USA); 10 pmol each primer and 0,6 U Taq DNA polymerase (Promega, USA), in a 25 ml volume. A 9700 thermocycler (Perkin Elmer, USA) was used and the PCR program included 30 cycles at 94ºC for 1 min; 63ºC for 45 s and 72ºC for 30 s and final extension at 72ºC for 5 min. PCR products were soaked at 4ºC and separated through electrophoresis. Agarose (Promega, USA) gels (1,5%) were prepared in 1X TAE buffer and electrophoresis was conducted at 100 V. Gels were then stained with Ethidium Bromide (Sigma), digitized and stored. Sequence comparisons were conducted with the ALIGN tool available in PC-GENE. RESULTS AND DISCUSSIONAccording to Shewry et al. (1992), there is a clear genetic association between baking quality and HMW glutenins allelic composition in wheat. Although there are also HMW loci in genomes A and B, their allelic richness precludes the development of gene-specific detection systems. Since there are only two main reported alleles in the HMW-D locus, detecting the presence or absence of just one allele allows deducting the allelic composition of any given wheat sample. The alignment of HMWx5 (GenBank accession X12928) and HMWx2 (GenBank accession X03346) sequences showed extensive conservation at the DNA level (similarity at the nucleotide level reached 98.5%). There were however some differences which allowed the specific amplification of the Glu-D1 HMWx5 over the Glu-D1 HMWx2 allele (Figure 1). The amplification of the Glu-D1 HMWx2 allele was attempted with primers 3 and 4, however a reduced reproducibility was observed (data not shown). Primers 1 and 2 amplify the HMWx5 allele residing on the D genome. Their length (19-20 nucleotides) provides the reliability required and their targets are shown in Figure 1. The optimized PCR mixture described, i.e., the use of a 25 ml reaction volume and 0.6 units of Taq polymerase, is much more cost effective than the method described by D'Ovidio and Anderson (1994), that used a reaction volume of 100 ml and 2.5 units of Taq DNA polymerase. This would further simplify its wide application in wheat breeding programmes since Taq DNA polymerase is the single most expensive reagent of PCR reactions. A perfect match was observed between the results of the PCR system and the actual allelic composition of wheat samples deducted from SDS-PAGE (Figure 2A). As shown in Figure 2A, the identification of Glu-D1 HMWx5 carrier genotypes is more straightforward at the gene rather than at the gene product level. Furthermore, in all blind experiments including a wide array of wheat genotypes the PCR system correctly detected the presence of the Glu-D1 HMWx5+y10 pair. Glu-D1 HMWx5+y10 and Glu-D1 HMWx2+y12 alleles are expected to occur in different wheat breeding programmes although at different frequencies. Such a feature would allow the application of the diagnostic system reported here to other wheat breeding programmes and to select carriers of the Glu-D1 HMWx5 allele onto which other desired traits could be introgressed. The tight genetic linkage existing between subunits x and y has hampered the development of genetic stocks to identify the actual subunit responsible for the baking quality properties related to them. Nevertheless, this is a significant advantage from a diagnostic standpoint, since the detection of either of them suffices to ascertain allelic composition. Figure 2B presents the results of the routine analysis of wheat genotypes through PCR. Discriminating between DNA samples carrying “good” or “bad” baking quality alleles is straightforward and simple and can be achieved in less than 3 hours with agarose gels. It also eliminates the use of hazardous reagents such as acrylamide. This diagnostic system shown eliminates inaccuracies due to the visual scoring of SDS-PAGE gels, since the molecular weights of the proteins encoded by alleles x5 and x2 are very similar (their molecular weight in Daltons deducted from DNA sequence are 89.059 and 90.486 respectively). Also, the mobility of HMW glutenins subunits is not always correlated to their actual molecular weights. Selection systems such as those reported here allow the detection of mutant HMWx5 alleles lacking a specific Cys residue, which are associated with reduced baking quality (D’Ovidio and Anderson, 1994). Such mutation cannot be detected with SDS-PAGE systems and would therefore go unnoticed, resulting in mistaken selection decisions. Selection errors can very expensive for breeding programs in terms of time and money. . Although it takes between 12 and 14 years to release a new winter wheat cultivar, they generally last in the market for no more than 5 years on average, mainly due to the loss of genetic tolerance to biotic stresses or the appearance of newer, higher yielding cultivars. Therefore it is necessary for breeding programmes to avoid any selection errors in order to remain efficient and competitive. A further advantage of this system is the use of any plant tissue (leaves, roots, seeds, stems), whereas conventional SDS-PAGE systems rely upon the availability of seed tissue. Being PCR based it only requires minute amounts of DNA, whereas alternative molecular methods for allele detection such as Southern blots would require micrograms of DNA. Therefore, it provides more flexibility and hastens the selection process, while reducing the volume of segregant lines reaching more advanced steps of the breeding programme. This system is currently used on a regular basis in the wheat breeding programme based at the Instituto de Investigaciones Agropecuarias- Centro Regional de Investigación Carillanca. The system reported here relies upon the Mendelian segregation of already existing or introgressed HMW alleles associated with baking quality and their monitoring through PCR. There is an alternative approach to introduce baking quality alleles into wheat, such as transgenesis (Alvarez et al., 2000). However, it may raise unexpected silencing and transgene expression issues derived from the high homology existing between HMWx2 and HMWx5 genes and the sheer complexity of the wheat genome. Furthermore, such transgenic genotypes may require regulatory approval before their commercialization that may increase their development expenses. The development of automatic systems for calling PCR amplicons will eliminate the use of agarose gels and further ease the application of this and other diagnostic systems used on a routine basis by wheat breeding programmes. Such research is ongoing and manuscripts are being prepared. Furthermore, alternative systems based upon HMWy alleles are also available which can also be used in selecting wheat genotypes with high baking quality (Ahmad, 2000). The increasing amount of plant derived Expressed Sequence Tags (ESTs) (Campos, 2002) deposited in databases represents a unique of source of protein encoding DNA fragments that could be used to develop assays such as that reported here once their allelic relationships are fully understood. The coordinated effort of molecular geneticists and plant breeders should allow the use of such information to develop new methods of genetic selection directly based on DNA data. Through multiplex PCR it becomes possible to amplify several different alleles per reaction, further reducing selection expenses. CONCLUSIONS The direct use of DNA information is a valuable tool to identify segregating breeding lines useful for plant breeders. The system reported here allows the steady identification of wheat breeding lines carrying HMWx5 alleles. ACKNOWLEDGEMENTS This research was funded through the competitive grant FONDEF D98I1074. REFERENCES
Copyright 2004 - Instituto de Investigaciones Agropecuarias, INIA (Chile). The following images related to this document are available:Photo images[at04023f2.jpg] [at04023f1.jpg] |
| |||||||||
