Biotecnologia Aplicada Elfos Scientiae ISSN: 0684-4551 Vol. 13, Num. 2, 1996

Isolation and characterization of Bacillus thuringiensis strains from Angola

B Paglietti^1 M Mura^1 G Scarpellini^1 I Pintus^1 A Satta^2 P Cappuccinelli^1 S Rubino^1^2 and R Prota^2

1 Istituto di Microbiologia e Virologia, Universita degli Studi di Sassari, Italia.

2 Istituto di Ricerca CNR sul Controllo Biologico dell' Ambiente, Sassari, Italia.

Code Number: BA96064
Sizes of Files:
    Text: 4.0K
    Graphics: No associated graphics files

Bacillus thuringiensis is a sporigen bacterium widely distribuited in soil. During sporulation B. thuringiensis is characterized by production of parasporal crystals composed of protein molecules of different weights (27-140 KDa) known as delta-endotoxin or insecticidal crystral proteins that are toxic to various insects. In insects, after ingestion, delta-endotoxins are converted in smaller polipeptydes by proteases. The interaction between active toxin and the midgut epithelium causes pores in the cellular membranes of the epithelium and successively osmotic shock.

Thirty-nine strains were isolated in soil samples collected from different regions of Popular Republic of Angola. B. thuringiensis strains were analyzed by morphology, production of spores and crystals and Polymerase chain reaction (PCR) technique.

A rapid analysis of B. thuringiensis strains predictive of insecticidal activity was established by using PCR.

Primers specific to regions of high homology within genes encoding two major classes of B. thuringiensis crystal proteins were used to generate a PCR product profile characteristic of each insecticidal class. Included in the screen were PCR primers specific for cryI (LEP) and cryIV (DIP) which are insecticidal for leptidopteran and dipteran respectively. Sequences of the primers are following:

DIP1A 5' CAAGCCGCAAATCTTGTGGA
DIP1B 5' ATGGCTTGTTTCGCTACATC
LEP1A 5' CCGGTGCTGGATTTGTGTTA
LEP1B 5' AATCCCGTATTGTACCAGCG

Results

Most of identified strains reacted with cryI gene primers (LEP) while only three showed to harbor cryIV gene (DIP). Results are summarized in table 1.

Table 1. PCR amplification of LEP and DIP genes.

isolates   LEP   DIP   is.   LEP   DIP   is.   LEP   DIP

---------------------------------------------------------

  AFI       -     -   AF21    -     -    AF41   -     -

  AF2       -     -   AF22    -     -    AF42   +     -

  AF5       -     -   AF23    -     -    AF44   +     -

  AF6       -     -   AF24    -     -    AF45   +     -

  AF9       +     -   AF25    +     -    AF46   +     -

 AF10       +     -   AF27    -     -    AF47   +     -

 AF11       -     -   AF30    -     -    AF48   -     -

 AF12       -     -   AF31    -     -    AF49   +     -

 AF13       -     -   AF32    -     -    AF50   -     +

 AF16       -     -   AF33    +     -    AF51   -     +

 AF17       -     -   AF37    +     -    AF53   -     +

 AF18       -     -   AF38    -     -    AF54   +     -

 AF19       -     -   AF40    -     -    AF55   -     -

Eighteen B. thuringiensis isolates were selected for a primary toxicity test against Ceratitis capitata (Dip. Tephritidae):

3 out of 18 (AF42, AF33 and AF37) caused a mortality (86,3 %, 62,1 % and 25,7 % respectively) statistically different from the control on larvae. We did not find any activity on adults with the exception of AF18 that showed a slight mortality of 24,3 % in 7 days. The potential activity of B. thuringiensis against Medfly and mosquitos could be used in future as pests biocontrol and thus replaces chemical insecticides.

Copyright 1996 Elfos Scientiae