 |
| About Bioline | All Journals | Testimonials | Membership | News |
|
||||||
|
||||||
Detection of genes for fimbrial antigens in Escherichia coli isolated from piglets with diarrhea in Camaguey *Roberto Basulto Baker,^1 Lesvia Calzada Aguilera,^1 Tania Olivera Gutierrez^1 and Jose de la Fuente Garcia^2
^1 Recombinant Vaccines Division, Center for Genetic Engineering and
Biotechnology, PO Box 387, Camaguey 1, Cuba. Tel: (53-322) 61014; Fax: (53-
322) 61587; E-mail: invest@cigbcam.cigb.edu.cu Received in April, 1996. Accepted for publication in January, 1997.
Code Number:BA97053
Size of Files:
Text: 30.9K
Graphics: Photographs (jpg) - 101.8K
ABSTRACT Specific DNA probes for genes encoding K88, K99, F41 and 987P fimbrial antigens were used to examine 142 Escherichia coli isolates from diarrheal cases (117 from pigs and 25 from calves). Ten isolates from pigs were adhesing gene positive with the DNA probes used: five K88^+, four 987P^+ and one K99^+F41^+. All were phenotypically positive when assayed for the expression of fimbrial antigens by enzyme-linked immunoabsorbent assays. In this study, 13 % of the pigs were infected by K88^+, K99^+F41^+ and 987P^+ E. coli strains. The existence for the first time in Cuba of 987P^+ and K99^+F41^+ native strains in pigs with diarrhea, detected with DNA probes, is reported. None of the isolates from calves resulted positive for K99 and/or F41. Key words: enterotoxigenic Escherichia coli, fimbrial antigen, diarrhea RESUMEN Se describe el uso de sondas de ADN especificas en la identificacion de los genes que codifican los antigenos fimbriales K88, K99, F41 y 987P en 142 aislamientos de E. coli de animales con diarrea (117 de cerdos y 25 de terneros). Diez aislamientos de cerdos resultaron positivos con las sondas utilizadas: cinco K88^+, cuatro 987P^+ y una K99^+F41^+, resultando todos ellos fenotipicamente positivos en el ensayo para la expresion de antigenos fimbriales por el sistema inmunoenzimatico. En este estudio, el 13 % de los cerdos neonatos analizados resulto ser portador de cepas de E. coli K88^+, K99^+F41^+ y 987P^+. Con el empleo de sondas de ADN se reporta por primera vez en Cuba la existencia de cepas autoctonas 987P^+ y K99^+F41^+ en cerdos neonatos con diarrea. Ninguno de los aislamientos de E. coli en terneros resulto positivo para K99 y/o F41. Palabras claves: Escherichia coli enterotoxigenica, antigeno fimbrial, diarrea Introduction The enterotoxigenic Escherichia coli (ETEC) causes diarrhea in newborn calves, sheep and pigs (1). These strains are characterized by having surface proteinaceous structures called fimbriae or colonization factors, which allow the strain to adhere to the epithelial cells of the small intestine. They also produce one or more of the heat-stable enterotoxins a and b (Sta and STb) and heat-labile enterotoxins (LT), which allow tissue liquids to move to the interior of the small intestine, causing diarrhea. Several antigenic colonization factors in animal ETEC have been reported so far: K88 (2), 987P (3), F42 (4), CS 1541 (5) and PCF O141 (6) isolated from piglets; K99 (7) and F41 (8) from piglets, lambs and calves; F165 (9) and CS 31A (10) from calves and piglets, and Att25 (11) and/or FY (F17) (12) isolated from calves only. To identify these antigens, various serological techniques have been used, e.g. ELISA with specific antibodies (13, 14) and hemagglutination of one or more types of erythrocytes, in the presence or absence of d-mannose (MRHA) (15).
The colony hybridization technique with genetic probes is the method more frequently used to detect ETEC strains and was reported to be as sensitive and specific as a biological and immunological method (16-19), and even more sensitive for K88 and K99 when compared with the ELISA methods and agglutination on microscope slides (20).
We reported the use of K88 and K99 specific probes to identify ETEC strains isolated from sick piglets (21). In this paper the use of K88, K99, F41 and 987P probes is reported in order to learn the incidence of diarrhea due to the strain in cattle and swine units in Camaguey. We also report, for the first time in Cuba, the existence of 987P^+ and K99^+F41^+ native strains detected with DNA probes in pigs with diarrhea. Materials and Methods Bacterial strains and media In this study, 142 E. coli isolates were used from animals in Camaguey, suffering intestinal infection from March to September 1994: 117 from 77 newborn pigs and 25 from 22 calves between 2 and 4 months of age. All the samples were collected by rectal exudates and taken to the laboratory in a Minca broth containing: KH2PO4 (1.36 g/L), Na2HPO4.2H2O (10.1 g/L), glucose (1 g/L), MgSO4 7H2O (10 mg/L), MnCl2.4H2O (1 mg/L), FeCl3.6H2O (0.135 mg/L), CaCl2.2H2O (0.4 mg) and Casamino acids (1 g/L) (22), supplemented with 1 g yeast extract (Oxoid) per liter of the medium. The isolation and identification of E. coli colonies were carried out in a MacConkey-agar selective medium, according to the methodology described (23). A panel of 8 ETEC reference strains was used as positive and/or negative controls for the colony hybridization experiments, agglutination on glass plates and the ELISA: G7 (O8:K87:K88ab), K88ac (O149:K91:K88ac), K88ad (O8:K87:K88ad), B44 (O101:K30:K99:F41), 431 (O101:K30:K99:F41), VAC-1676 (O101: K30: F41), KATI-1706 (O101: K30: F41) and 987P (O9:K103:987P). Isolation of total genomic DNA A single bacterial colony was transferred into 100 mL of the Luria broth (LB) medium and incubated overnight at 37 C with vigorous shaking. The cells were collected by centrifugation at 12 000 rpm for 5 min. The pellet was resuspended in 8 mL of TE 1X buffer (10 mM Tris HCl, 1 mM EDTA, pH 8.0), and 0.8 mL of a freshly prepared solution of Lysozime (10 mg/mL in the same buffer) was added. The mixture was incubated for 30 min, slowly shaken at 37 C. Later, 0.2 mL of 0.5 M EDTA solution, 0.5 mL self-digested Pronase (20 mg/mL), RNAse A to a final concentration of 50 ug/mL and 1.1 mL of the SDS solution at 10 %, were added. An equal volume of phenol- chloroform was added after incubating for 1 h at 37 C in a shaker at low speed. After the third extraction with phenol, the aqueous phase was transferred to a fresh centrifuge tube and 0.2 volume of 10 M ammonium acetate and two volumes of ethanol were added. The DNA precipitate was removed from the ethanol solution with a Pasteur pipette with a sealed end shaped into a U. The precipitate was washed twice with 70 % ethanol. The DNA was resuspended in TE 1X and stored at 4 C. Generation of DNA probes The K88 probe was an internal fragment of 803 bp of the K88ab gene, amplified by polymerase chain reaccion (PCR) from the G7 strain with the oligonucleotides that recognize the K88ab intragenic region: 5'd (TGGATGACTGGTGATTTCAAT)-3'and 5'd (CAGGATCCTTAGTAATAAGTTATT)-3'. The K99 probe was a ClaI/BamHI fragment of 543 bp from the previously described pSUFK99 plasmid (21). To obtain the internal fragments of the F41 (712 bp) and 987P (470 bp) genes, the following oligonucleotides were used respectively: 5'd (ATGGATCCCAGGTGACATTATTAT)-3' and 5'd (AAAAGCTTCCGCAACATCCTTATT)-3', 5'd (AAGGATCCCGCTGAAAACAACACC)-3' and 5'd (GGAAGCTTCTCCACCGTTTGTATC)-3' designed from the DNA sequences previously reported for these fimbrial subunits (24, 25).
The amplification reactions were carried out in accordance with the procedure described (26) in a volume of 100 uL containing 1 ug of total DNA from the VAC-1676 or 987P reference strains, 10 uL of T. aquaticus DNA polymerase 10X buffer (166 mM (NH4)2SO4, 670 mM Tris HCl (pH 8.8 at 25 C), 67 mM MgCl2, 100 mM 2-Mercaptoethanol, 1.7 mg/mL of BSA), 50 pmol of each primer; 3 units of T. aquaticus DNA polymerase (Heber-Biotec S.A., Cuba), and 0.25 mM of each dNTP. The mixture was overlaid with 50 uL of mineral oil in order to prevent evaporation.
The reaction for F41 was initially denatured for 5 min at 94 C, followed by 3 amplification cycles of: denaturation 1 min at 94 C, hybridization 1 min at 42 C, extension 1 min at 72 C, and 26 cycles of: denaturation 1 min at 94 C, hybridization 1 min at 50 C, and extension 1 min at 72 C.
The reaction for 987P was initiated by denaturation for 5 min at 94 C, followed by 3 amplification cycles of: denaturation 1 min at 94 C, hybridization 1 min at 52 C, extension 1 min at 72 C, and 26 cycles of: denaturation 1 min at 94 C, hybridization 1 min at 63 C, and extension 1 min at 72 C.
The extension time and temperature for the 30th cycle in each case was of 5 min at 72 C. The PCR's were performed in water baths. The amplified fragments were recovered from a 1.0 % low-melting-temperature agarose gel according to Maniatis et al. (27). Labeling and hybridization The labeling of K88, K99, F41 and 987P DNA probes was performed (28) with 50 ng of each fragment, and 25 uCi of [alpha-32 P]dATP (Amersham, UK), using random oligonucleotide primers and the Klenow fragment of E. coli DNA polymerase I (Heber-Biotec S.A., Cuba). Strains were spotted onto the Minca agar and incubated at 37 C for several hours until colonies (phi 1.0-1.5 mm) appeared. Colonies were then transferred to 4 nitrocellulose membranes (95 mm diameter). Each filter was put in a glass beaker and transferred to an incubator shaker in which all prehybridization, hybridization and post-hybridization washes were carried out. The hybridization solution contained 5X SSC (1X SSC: 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0), 5X Denhardt's solution (1X Denhardt's: 0.02 % (w/v) BSA (fraction V), 0.02 % (w/v) Ficoll (Mr 400 000), 0.02 % (w/v) polyvinyl-pyrrolidone (Mr 360 000)), 0.2 % (w/v) SDS and 50 % Formamide. Post hybridization washing solutions were (A) 2X SSC-0.1 % (w/v) SDS and (B) 0.2 X SSC-0.1 % (w/v) SDS. Filters were prehybridized in the hybridization solution containing 100 ug/mL denatured tRNA for 4 h at 42 C before adding heat denatured (100 C for 5 min) radiolabelled probes (50 ng DNA probe per filter) and were hybridized in the hybridization solution (50 uL/cm^2) for 16 h at 42 C. After hybridization, the filters were washed separately in A and B solutions 2 times for 15 min each at room temperature. For autoradiography, filters were removed from the beakers, air dryed and exposed with intensifying screens for periods ranging from 1 to 7 h. Antigen expression and purification The K99 and F41 strains were grown in the Minca broth (supplemented with 1 g/L of the yeast extract) for 3.5 h and 4 h at 37 C, respectively. The antigens were extracted using 50 mM phosphate buffer (pH 5.5) and 0.9 % NaCl at 60 C for 25 min (the F41 antigen extraction was repeated twice). The K88 strain was grown in the Minca broth (supplemented with 10 g/L of the yeast extract) for 3.5 h at 37 C. The extraction was performed with 50 mM phosphate buffer (pH 7.2) at 60 C for 25 min.
The 987P strain was grown in the Minimal medium (29), supplemented with 2 g/L of glucose and 1 g/L of yeast extract for 4 h at 37 C. The extraction was performed with 10 mM Tris HCl, pH 7.5 at 60 C for 30 min (twice). ELISA for qualitative determination of K88, K99, F41 and 987P antigens Microtiter plates (96 wells, NUNC) were coated overnight at 4 C with 100 uL of 10 ug/mL CBC K88a-1, CBC K99-2, CBC F41-1 and CBC 987P-1 monoclonal antibodies dissolved in 0.1 M carbonate/bicarbonate buffer (pH 9.6). The wells were saturated by incubation for 1 h at 37 C in 1 X PBS buffer (pH 7.2) with 0.05 % (w/v) skim milk. After 4 washes with 0.05 % (v/v) Tween 20, 100 uL of the purified antigens were added to the wells and the plates were incubated for 3 h at 37 C. After incubation, the wells were washed again 4 times and 100 uL of peroxidase-conjugated (HRP) CBC K88a-1 (1/10 000), HRP CBC K99-2 (1/10 000), HRP CBC 987P-1 (1/4000) and HRP anti-F41 rabbit polyclonal antisera (1/6000) were added. After 1 h of incubation at 37 C and 4 additional washes with 0.05 % Tween 20, peroxidase activity was revealed by addition of 100 uL of a 50 mM citrate/phosphate buffer solution containing 0.05 % (w/v) o- phenylenediamine and 0.05 % (v/v) H2O2. The reaction was stopped 30 min later by adding 50 uL of a 2N H2SO4 solution. The optical density (OD) at 492 nm was determined in a plate reader (Multiskan Titertek MCC 340, Finland). The samples that had OD values > 0.3 were considered positive. Agglutination and staphylococcal coagglutination assays The agglutination and coagglutination assays (15) were performed using the following specific polyclonal antisera: anti-K88 and anti-F41 adhesins in sheep and rabbit, respectively and anti-K99 and anti-987P adhesins in rabbit coupled to protein A. Using the pellicle formed on the surface of the Mueller-Hinton broth, K88 and 987P E. coli strains were cultured in CFA agar (30), and F41 and K99 E. coli strains in the Minca at 37 C for 18 h. The bacteria were suspended in phosphate buffer saline (PBS). Separately, a drop of each antiserum coupled to protein A (31) for K99 and 987P or not coupled to protein A for K88 and F41 was put on a glass slide together with a drop of the bacterial suspensions. The mixture was gently shaken for 1 min at room temperature, and observed for the presence of an agglutination reaction. The positive bacteria reacted against the specific antiserum producing visible clots on a dark bottom. Results Validation of DNA probes against reference ETEC strains Specific DNA probes to detect the fimbrial antigens were used in colony hybridization experiments against a panel of enterotoxigenic E. coli reference strains (Table 1). Each strain was assayed for the expression of the antigens using ELISA, agglutination and staphylococcal coagglutination techniques. Table 1. Validation of specific gene probes by hybridization, ELISA, agglutination and coagglutination against reference ETEC strains of known serotype.
---------------------------------------------------------------------------
Strain Hybridization ELISA Agglutination and
coagglutination
------------------- ------------------- -------------------
K88 K99 F41 987P K88 K99 F41 987P K88 K99 F41 987P
---------------------------------------------------------------------------
G7 + - - - + - - - + - - -
K88ac + - - - + - - - - - - -
K88ad + - - - + - - - + - - -
B44 - + + - - + + - - + - -
431 - + + - - + + - - + + -
1676 - + + - - - + - - - - -
1706 - + + - - - + - - - + -
987P - - - + - - - + - - - +
---------------------------------------------------------------------------
+: positive; -: negative; +/-: uncertain.An exact correlation between the detected genes and the antigens expressed by each strain was observed (Table 1). VAC-1676 (O101:K30:F41) and KATI- 1706 (O101:K30:F41) strains, reported (32) as F41, but not as K99 antigen producers, resulted positive after the hybridization assay with the specific probe to detect the K99 gene (Figure 1B, Table 1).
Internal fragments of the genes coding for K88 and F41 antigens were used as probes regarding the wide homology among the genetic determinants that mediate the expression of these adhesins (24). With the K88 probe derived from the G7 reference strain (K88ab), all the strains that contained the gene for K88 expression, were identified, regardless the subtype (Figure 1A, Table 1). Similar observations have been reported (33). Detection of genes for fimbrial antigens in E. coli strains isolated from diarrheal calves and pigs
Using specific probes for K88, K99, F41 and 987P, 142 E. coli isolates from diarrheal calves and pigs, were analyzed. Out of 117 swine isolates, 10 were positive: 5 K88^+, 4 987P^+ and 1 K99^+F41^+ (Figure 1, Table 2). They corresponded to 10 E. coli strains, since 3 K99^+F41^+ isolates were actually one cellular clon isolated from the same sample. None of the 25 isolates from calves were positive for K99 and/or F41. Table 2. Genotypic and phenotypic characterization of native E. coli swine strains.
--------------------------------------------------------------------------
Strain Hybridization ELISA Agglutination and
coagglutination
------------------- -------------------- --------------------
K88 K99 F41 987P K88 K99 F41 987P K88 K99 F41 987P
--------------------------------------------------------------------------
26 - - - + - - - + - - - +/-
27 - - - + - - - + - - - +/-
51 - + + - - + + - - +/- + -
52 - + + - - + + - - +/- + -
53 - + + - - +/- + - - +/- + -
69 - - - + - - - + - - - +
78 + - - - + - - - + - - -
119 + - - - + - - - + - - -
134 + - - - + - - - +/- - - -
135 + - - - + - - - + - - -
136 - - - + - - - + - - - +
139 + - - - +/- - - - +/- - - -
--------------------------------------------------------------------------
+: positive; -: negative; +/-: uncertain.Expression of fimbrial antigens in isolated E. coli strains The E. coli positive isolates, were assayed for the expression of the antigens by ELISA, agglutination and staphylococcal coagglutination. Table 2 shows the existence of a good correlation between the phenotype and genotype assays in the detection of fimbrial genes and antigens expressed by each of the native E. coli strains. Discussion The use of 4 specific probes for the detection of K88, K99, F41 and 987P genes is technically simple and has a considerable potential for comprehensive epidemiological studies because it allows the simultaneous analysis of hundreds and thousands of samples, with a high specificity and sensitivity. The sensitivity and specificity of the ELISA were better than the agglutination and coagglutination assays (Tables 1 and 2). Strains VAC-1676 (O101:K30:F41) and KATI-1706 (O101:K30:F41) were chosen as the positive control for hybridization assays with the F41 probe, since they were 2 of the 3 virulent strains reported to produce F41 antigens but not K99 antigens. These strains did show homology with the K99 gene probe used, but K99 homology was localized in a plasmid (32) which had lost its capacity to express the K99 antigen due to a spontaneous mutation (34).
In this study, 13.0 % of the piglets assayed were infected with K88^+, K99^+F41^+ and 987P^+ E. coli strains. Our results support the previously reported relation between the antigenic factors of colonization and the host (35). It must be stressed that of all E. coli isolates from one swine unit, only 2 were 987P^+, while none was K88^+, K99^+ and/or F41^+, because the diarrheal samples belonged to piglets from sows previously immunized with the recombinant vaccine against swine colibacilosis (VACOLI, Heber-Biotec S.A., Cuba), containing the purified recombinant ETEC K88ab and K99 antigens. In fact, VACOLI offers high protection to piglets against the K88 and K99 strains (36).
The E. coli that produces the heat-stable enterotoxin Sta and K99 antigen for intestinal colonization, has presented much lower incidence rates on newborn calves. Several studies support this conclusion. In England and Scotland, 8 % (37); in some regions of France, 0 - 5 % (38, 39) and in Japan, 4 % (40). In Galicia, Spain (15) only 6 (0.7 %) of the 858 E. coli bovine strains isolated between 1980 and 1991 resulted K99 and/or F41 positive (95 % of the samples came from calves of less than one month, and between one and three months of age). According to the poor number of samples analyzed and the age, we can not conclude that the K99^+ and/or F41^+ strains are seldom a cause of diarrhea in newborn calves in the province of Camaguey. Therefore, isolation and characterization of bovine E. coli strains should continue until completing the epidemiological study in the whole country. The results will allow us to learn whether a vaccine containing the K99 and/or F41 antigens can be applied to the bovine population. Aknowledgements
The authors would like to thank C.R. Chong and R.G. Gonzalez (Vet. Fac., Univ. of Camaguey) for providing us the E. coli native strains used in the study, Dr. V. Jimenez (CIGB, Havana) for the oligonucleotide synthesis, Dr. J. Junco (CIGB, Camaguey) for the ELISAs performed, and Eng. M. Ramos and L.D. Gonzalez (CIGB, Camaguey) for their support in the preparation and translation of the manuscript. References 1. Tzipori S. The relative importance of enteric pathogens affecting neonates of domestic animals. Adv Vet Sci Comp Med 1985;29:103-106. 2. Orskov I, rskov F, Sojka WJ, Leach JM. Simultaneous occurrence of E. coli B and L antigens in strains from disease swine. Acta Pathol Microbiol Scand 1961;Sect. B 53:404-422. 3. Isaacson RE, Nagy B, Moon HW. Colonization of porcine small intestine by E. coli: colonization and adhesion factors of pig enteric pathogens that lack K88. J Infect Dis 1977;135:31-539. 4. Yano T, Leite DS, Camargo IJB, Pestana de Castro AF. A probable new adhesive factor (F42) produced by enterotoxigenic E. coli isolated from pigs. Microbiol Immunol 1986;30:495-508. 5. Broes A, Fairbrother JM, Jacques M, Lariviere S. Isolation and characterization of a new fimbrial antigen (CS1541) from a porcine ETEC O8:KX105 strain. FEMS Microbiol Lett 1988;55:341-348. 6. Kennan RM, Monckton RP. Adhesive fimbriae associated with porcine ETEC of the O141 serotype. J Clin Microbiol 1990;28:2006-2011. 7. Moon HW, Nagy B, Isaacson RE, Orskov I. Ocurrence of K99 antigen on E. coli isolated from pigs and colonization of pig ileum by K99 positive ETEC from calves and pigs. Infect Immun 1977; 15:614-620. 8. Morris JA, Thorns C, Scott AC, Sojka WJ, Wells GA. Adhesion in vitro and in vivo associated with and adhesive antigen (F41) produced by a K99 mutant of the reference strain E. coli B41. Infect Immun 1982;36:1146-1153. 9. Pohl P, Lintermans P, Moury J, Van Muylem K, Marin M. Facteurs de virulence chez les E. coli septicemiques et saprophytes du veau. Ann Med Vet 1986;130:515-520. 10. Girardeau JP, der Vartanian M, Ollier JL, Contrepois M. CS31A, a new K88- related fimbrial antigen on bovine enterotoxigenic and septicemic E. coli strains. Infect Immun 1988;56:2180-2188. 11. Pohl P, Lintermans P, Kaeckenbeeck A, de Moll P, Van Muylem K, Schotte M. Existence de differents types d' E. coli pathogenes pour l' intestin du veau. Ann Med Vet 1983;127:37-41. 12. Contrepois M, Martel JL, Bordas C, Hayers F, Millet A, Ramisse J, Sendral R. Frequence des pili FY et K99 parmi des souches de E. coli isolees de veaux diarrheiques en France. Ann Rech Vet 1985;16:25-28. 13. Mills KW, Tietze KL. Monoclonal antibody ELISA for identification of K99- positive E. coli isolates from calves. J Clin Microbiol 1984;19:498-501. 14. Raybould TJG, Crouch CF, Acres SD. Monoclonal antibody passive hemaglutination and capture ELISA for direct detection and quantitation of F41 and K99 fimbrial antigens in ETEC. J Clin Microbiol 1987;25:278-284. 15. Blanco J, Blanco M, Blanco JE, Alonso MP, Garabal JJ, Gonzalez EA. E. coli enterotoxigenicos, necrotoxigenicos, y verotoxigenicos de origen humano y bovino: patogenesis, epidemiologia y diagnostico microbiologico. Ed. Servicio de Publicaciones de Lugo, Spain, 1993. 16. Moseley SL, Hug I, Alim ARMA, So M, Samadpour-Motaleby M, Falkow S. Detection of ETEC by DNA colony hybridization. J Infect Dis 1980;142: 892- 898. 17. Moseley SL, Echeverria P, Seriwatana J, Tirapat C, Chaicumpa W, Sakuldaipeara T, Falkow S. Identification of ETEC using three enterotoxin genes probes. J Infect Dis 1982;145: 863-869. 18. Mainil JG, Bex F, Jacquemin E, Pohl P, Couturier M, Kaeckenbeeck A. Prevalence of four enterotoxin (STaP, STaH, STb, and LT) and four adhesin subunit (K99, K88, 987P, and F41) genes among E. coli isolates from cattle. Am J Vet Res 1990;51:187-190. 19. Harel J, Lapointe H, Fallara A, Lortie LA, Bigras-Poulin M, Lariviere S, Fairbrother JM. Detection of genes for fimbrial antigens and enterotoxins associated with E. coli serogroup isolated from pigs with diarrhea. J Clin Microbiol 1991;29:745-752. 20. Monckton RP, Haase D. Detection of ETEC piggeries in Victoria by DNA hibridization using K88, k99, LT, ST1, and ST2 probes. Vet Microbiol 1988;16:273-281. 21. Borroto A, Basulto R, Moreno M, Silva R, Wong I, Bover E et al. Clonacion de las subunidades fimbricas K88ab y K99 e identificacion de cepas de E. coli enterotoxigenicas aisladas de cerdos enfermos. Biotecnologia Aplicada 1992; 9:148-155. 22. Guinee PAM, Jansen WH, Agterberg CM. Detection of the K99 antigen by means of agglutination and immunoelectrophoresis in E. coli isolates from calves and its correlation with enterotoxigenicity. Infect Immun 1976;13: 1369-1377. 23. Edwards PS, Ewing WH. Identification of the Enterobacteriaceae. Vol. 1, Cap. 13, Burgess Publishing Co., Minneapolis, USA, 1972. 24. Anderson DG, Moseley SL. E. coli F41 adhesin: genetic organization, nucleotide sequence, and homology with the K88 determinant. J Bacteriol 1988; 170:4890-4896. 25. de Graaf FK, Klaasen P. Nucleotide sequence of the gene encoding 987P fimbrial subunit of E. coli. FEMS Microbiol Lett 1987;42:253-258. 26. Saiki RK, Gelfand DH, Stoffel S, Scharf J, Higuchi R, Horn GT et al. Primer directed enzymatic amplification of DNA with a termostable DNA polymerase. Science 1988;239:487-491. 27. Maniatis T, Fritsch CJ, Sambrook J. Molecular Cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 1989;1:6.30-6.31. 28. Feinberg AP, Vogelstein BA. A technique for radiolabelling DNA restriction endonuclease fragment to high activity. Anal Biochem 1984;132:6-13. 29. van der Woude MW, de Graaf FK, van Verseveld HW. Production of the fimbrial adhesin 987P by ETEC during growth under controlled conditions in a Chemostat. Journal of General Microbiol 1989;135:3421-3429. 30. Evans DG, Evans DJ. New surface-associated heat-labile colonization factor antigen (CFA / II) produced by ETEC of serogroups O6 and O8. Infect Immun 1978;21:638-647. 31. Kronval GA. A rapid slide-agglutination method for typing pneumococci by means of specific antibody adsorbed to protein A-containing staphylococci. J Med Microbiol 1973;6:187-190. 32. Moseley SL, Dougan G, Schneider RA, Moon HW. Cloning of chromosomal DNA encoding the F41 adhesin of ETEC and genetic homology between adhesins F41 and K88. J Bacteriol 1986; 167:799-804. 33. Lanser JA, Anargyros PA. Detection of E. coli adhesins with DNA probes. J Clin Microbiol 1985;22:425-427. 34. Issacson RE, Patterson S. Analysis of a naturally occurring K99^+ ETEC strain that fails to produce K99. Infect Immun 1994;62:4686-4689. 35. Wray C, Morris JA. Enteric deseases in newborn piglets, calves and lambs caused by ETEC. J Hyg 1985;95:577-585. 36. Wong I, Moreno M, Molerio M, Valderrama S, Jouglar M, Horrach M et al. Immunity and protection elicited by a recombinant vaccine against enterotoxigenic E. coli. Biotecnologia Aplicada 1995;12:9-15. 37. Sherwood D, Snodgrass DR, Lawson GHK. Prevalence of ETEC in calves in Scotland and northern England. Veterinary Record 1983;113:208-212. 38. de Rycke J, Bernard S, Laporte J, Naciri M, Popoff MR, Rodolakis A. Prevalence of various enteropathogens in the feces of diarrheic and healthy calves. Ann Rech Vet 1986;17:159-168. 39. Kumar A, Contrepois M, Tchen P, Cohen J. Non-radioactive oligonucleotide probe for detection of clinical ETEC isolates of bovine origen. Ann Inst Pasteur/Microbiol 1988;139:315-323. 40. Shimizu M, Sakano T, Yamamoto J, Kitajima K. Incidence and some characteristics of fimbriae FY and 31A of E. coli isolates from calves with diarrhea in Japan. Microbiol Immunolog 1987;31: 417-426. Copyright 1997 Elfos Scientiae The following images related to this document are available:Photo images[ba97053a.jpg] |
| |||||||||
