Journal of Culture Collections National Bank for Industrial Microorganisms and Cell Cultures ISSN: 1310-8360 Vol. 5, Num. 1, 2006, pp. 46-57

Journal of Culture Collections, Volume 5, 2006-2007, pp. 46-57

Chantaraporn Phalakornkule^1* and Somboon Tanasupawat²

¹Department of Chemical Engineering, Faculty of Engineering, King Mongkut’s Institute of Technology, North Bangkok 10800, Thailand;
²Department of Microbiology, Faculty of Pharmaceutical Sciences, Chulalongkorn University, Bangkok 10330, Thailand

*Corresponding author, e-mail: cpk@kmitnb.ac.th, cphalak21@yahoo.com

Code Number:cc06007

Lactic acid bacteria from traditional Thai fermented sausages were characterized. The fermented sausages were mainly produced from minced pork/beef or pork/beef liver. Sixty five strains were isolated from 12 samples collected from the central and northeastern parts of Thailand. The strains were identified by conventional morphological, cultural, physiological and biochemical tests as well as by 16S rDNA sequence analysis. The isolates were identified as Weissella cibaria/kimchii (5), W. confusa (3), Pediococcus pentosaceus (20), P. acidilactici (2), Lactobacillus fermentum (3), L. brevis (4), L. farciminis (4), L. plantarum (23), and L. sakei (1). Some of these species have not been previously isolated from Thai fermented sausages. The inhibition tests against Bacillus cereus and Staphylococcus aureus showed that 5 isolates could inhibit the growth of B. cereus and 2 of them could also inhibit S. aureus. The isolates were identified as W. confusa (1), P. acidilactici (1), L. plantarum (3). Three strains identified as L. plantarum and one as Weissella spp. could produce diacetyl.  

Key words: fermented sausage, lactic acid bacteria, Weissella, Lactobacillus, Pediococcus, 16S DNA, diacetyl, bacteriocin.

Sai-krork-prieo” is a traditional Thai fermented sausage, consumed all around the country and produced from minced pork, garlic, pepper, spices, salt and sugar. “Mum” is a product similar to “Sai-krork-prieo”, but can be made from beef as well as pork, and is popular only in the Northeastern of Thailand.

Lactic acid bacteria (LAB) play an important role in the ripening process of raw fermented sausages. However, the production of traditional fermented sausages in Thailand has utilized the naturally occurring LAB, resulting in various and inconstant products. Natural fermentations could vary from the simple to the complex ones. In general, each fermentation takes place under conditions that the producers have found to be favorable for the appropriate growth and action of micro-organisms. Alternative to the natural fermentation, the use of well-studied starter cultures would result in more constant and safe food products.

The aim of this study was the isolation and identification of LAB from traditional fermented sausages in Thailand. In addition, their capability of producing metabolic compounds with antimicrobial property, i.e., diacetyl and bacteriocins, is reported. The strains found in this study have a potential use in the establishing of the so-called “functional foods” [12, 17].

Materials and methods

Sample collection, bacterial cell counts, and isolation method. Twelve fermented sausage samples of various brands were collected from factories and local markets. The pH of the samples was represented by the pH of the suspension of a 5-gram portion in 10 ml de-ionized water. The cell numbers were counted by a plating method on De Man, Rogasa and Sharpe agar (MRS agar) [3] at 30 ^oC after a 3- to 5-day incubation. Pure cultures were obtained by streaking cultured cells on MRS agar plates with 0.2 % CaCO₃.

Morphological and cultural characteristics. Cell form, cell size, cell arrangement, and colony appearance were examined on cells grown on a half strength MRS (MRSH) agar incubated for 3 days. Hucker-Conn modification [8] was used for gram stain. Spore formation was examined in gram-stained specimens. Motility was detected by the appearance of stab cultures in soft agar [30].

Biochemical and physiological characteristics. Catalase, nitrate reduction, hydrolysis of esculin, arginine, slime formation and re-actions in litmus milk were investigated as described by Tanasupawat et al. [20, 23]. Catalase activity was detected on cells grown on MRSH agar. Nitrate reduction was tested after incubation of cells for 7 days in a medium com-posed of 1.0 g KNO₃, 3.0 g yeast extract, 5.0 g peptone, 0.2 g beef extract, 5.0 g NaCl, 0.25 g Tween 80, 1.0 g agar, and 1000 ml deionized water, adjusted to pH 6.8. Growth at different temperature (30, 45, and 50 ^oC), at different starting pH (3.5, 4.0, 4.5, 8.0, 8.5 and 9.6), and at different concentrations of NaCl (4, 6, 8, and 10 %) were tested by using MRSH broth. The production of gas from D-glucose was examined by using MRS broth with a Durham tube. Acid production from carbohydrates was deter-mined as described in Tanasupawat et al. [23] by the use of a basal medium of GYPB broth with the omission of glucose. The GYPB medium contained 10.0 g glucose, 5.0 g yeast ex-tract, 5.0 g peptone, 2.0 g beef extract, 2.0 g sodium acetate, 0.25 g Tween 80, 200 mg MgSO₄×7H₂O, 10 mg MnSO₄×4H₂O, 10 mg FeSO₄×7H₂O, 5.0 g NaCl, and 1000 ml deionized water, adjusted to pH 6.8. The acid produced in 3 ml broth was titrated with 0.1 N NaOH.

Peptidoglycan type of the cell wall. Meso-diaminopimelic acid (DAP) in the cell wall was detected by hydrolysis of 3 mg dried cells grown in GYPB broth. Hydrolysis was performed with 1 ml 6 N HCl at 100 ^oC for 18 h, and the hydrolysate was applied on cellulose TLC plate (Merck no. 5577). The TLC plate was developed with the solvent system of methanol-pyridine-12 N HCl-water (80: 10: 1.5: 17.5) (v/v) [11]. Spots were visualized by spraying with 0.5 % ninhydrin solution in n-butanol followed by heating at 100 ^oC for a few minutes.

Isomers of lactic acid. The strains tested were cultivated in GYPB broth for 3 to 5 days. Lactic acid was analyzed enzymatically ac-cording to Okada et al. [15] using D- and L-lactate dehydrogenase (Boehringer, Germany).

Screening for diacetyl formation. Diacetyl formation was screened by the method modified from Mattessich and Cooper [13] and Phalip et al. [16], which yielded qualitative results. Cells were grown in MMRS broth at 35 ^oC for 3-5 days. Hundred ml of the MMRS broth contained 0.18 g glucose, 0.5 g yeast extract, 1.0 g peptone, 1.0 g beef extract, 0.5 g sodium acetate, 1.29 g trisodium citrate x 2H₂O, 0.15 g Tween 80, 0.02 g MgSO₄×7H₂O, 0.005 g MnSO₄×H₂O, and 0.2 g K₂HPO₄. One ml of each test solution (0.5 % creatine solution and 7.5 % a-naphthol in 2.5 N NaOH) was added into each 3 ml of culture medium. The degree of change in the culture medium color was recorded.

Screening for bacteriocin production. The screening method was modified from Yin et al. [31]. Each LAB strain was grown on Trypticase soy agar (without glucose) with a 2.0 % yeast extract supplement (TSAYE) slant at 37 ^oC for 2 days. The cultured LAB cells were streaked on TSAYE plate. Working pathogens (Bacillus cereus TISTR 037 and Staphylococcus aureus TISTR 029 from Thailand Institute of Scientific and Technological Research) were cultured in nutrient agar (NA) slant at 37 ^oC for 2 days. The cultured pathogen cells were transferred to 0.85 % saline solution to obtain a cell density of 10⁵-10⁶ colony-forming units (CFU) per ml. One ml of the suspended pathogen cells was mixed with 15 ml of melted Trypticase soy agar (TSA) at 50 ^oC. The melted TSA was then overlaid on the TSAYE plate with growing LAB. The plate with the overlay was incubated anaerobically at 37 ^oC for 2 days. The control TSAYE plate with a pathogen overlay but without cultured LAB was incubated in parallel for comparison. Inhibition zones reveal-ed by colony appearance were recorded.

Sequencing and comparison of 16S rRNA gene. Template DNA for 16S rRNA gene amplification was prepared by the method modified from Nilsson et al. [14]. Two loops from an overnight MRS plate culture were transferred into 100-500 µl of TE buffer (10 mM Tris-Cl, pH 7.5, and 1 mM EDTA). Samples were boiled for 10-15 min. Then, the debris was pelleted by centrifugation at 12000 rpm for 10 min, and 50-200 µl of the supernatant was collected. The 16S rRNA gene was amplified using the PCR method with a 1U Taq DNA polymerase (Bio-Lab Ltd., Auckland, New Zealand) and the primers UFUL (GCCTAACACATGCAAGTCGA) and URUL (CGTATTACCGCGGCTGCTGG) (Great American Gene Co., California, USA). These primers target two highly conserved re-gions known to be variable among bacterial species [4, 29]. The 16S rRNA gene was sequenced by using a BigDye v. 3.1 cycle sequencing kit (Applied Biosystems, California, USA), according to the manufacturer’s protocol, with UFUL as primer. The 16S rRNA gene sequences determined (ca. 400-500 bases) were aligned along with the sequences of type strains obtained from the GenBank by using the program CLUSTAL X (version 1.82) [28]. Distance matrices for aligned sequences were calculated by the two-parameter method of Kimura [10]. A phylogenic tree was constructed by the neighbor-joining method [18] with the program PHY-LIP (version 3.64) available at http://evolution. genetics.washington.edu/phylip.html. Confidence values of individual branches in the phylogenetic tree were determined by using the bootstrap analysis of Felsenstein [5] based on 1,000 samplings.

Reference strains. Weissella confusa ATCC 10881^T, W. cibaria/kimchii LMG 17699^T, Pediococcus pentosaceus ATCC 33316^T, P. acidilactici DSM 20284^T, Lactobacillus fermentum ATCC 14931^T, L. brevis ATCC 14869^T, L. farciminis ATCC 29644^T, L. plantarum ATCC 14917^T and L. sakei ATCC 15521^T were used as reference strains.

Results

Bacterial cell counts and sausage characteristics

Twelve samples from Thai fermented sausages collected from the central and north-eastern parts of Thailand were studied. The tested samples contained 1.4 x 10¹¹-5.5 x 10¹³ bacterial cells/g, and showed a pH between 4.2 and 5.0 (Table 1).

Table 1. Bacterial cell counts and sausage characteristics.

Morphological and cultural characteristics

All isolates were Gram-positive, non-mo-tile, and nonsporing. The cells of 30 sphere-shaped strains measured 0.8 to 1.0 µm in size and appeared in pairs or in tetrads (Table 2). Their colonies on MRS agar plates were circular, low convex with entire margin, and non-pigmented. The cells of 35 rod-shaped strains measured 0.8-1.0 x 1.5-5.0 µm in cell size, and appeared singly, in pairs, or in chains (Table 3). Their colonies on MRS agar plates were circular, low convex with entire margin, and non-pigmented.

Table 2. General characteristics of group A strains.

Legend: positive (+), weakly positive (W), negative reaction (-), not determined (ND); numbers in parenthesis indicate the number of strains showing a positive or negative reaction; diaminopimelic acid (DAP); American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSM), Japan Collection of Microorganisms (JCM).

¹Data from [1, 2, 7, 9, 19, 24, 26]; ² Data from [1]; ³ Data from [25].

Table 3. General characteristics of group B strains.

Legend: positive (+), weakly positive (W), negative reaction (-), not determined (ND); numbers in parenthesis indicate the number of strains showing a positive or negative reaction; diaminopimelic acid (DAP); American Type Culture Collection (ATCC).

¹Data from [24]; ²Data from [23, 27]; ³Data from [20, 24, 26]; ⁴Data from [24].

Physiological and biochemical characteristics

Isolates were divided into two major groups, Groups A and B by cell shape. Group A consisted of 30 sphere-shaped isolates, which were further divided into 2 subgroups according to gas production from glucose. Subgroup A1 produced gas from glucose (8 strains), while subgroup A2 did not (22 strains). All strains in subgroup A1 did not grow at 45 ^oC. Subgroup A2 was further divided into 2 subgroups ac-cording to their growth at different temperatures. Subgroup A21 grew at 45 ^oC (20 strains); and subgroup A22 grew at 50 ^oC (2 strains).

Group B consisted of 35 rod-shaped isolates, which were further divided into 2 subgroups according to gas production from glucose. Sub-group B1 produced gas from glucose (7 strains), while subgroup B2 did not (28 strains). Sub-group B1 was further divided into 2 subgroups according to their growth at different temperatures. Subgroup B11 grew at 45 ^oC (3 strains); and subgroup B12 did not grow at 45 ^oC (4 strains).

All strains in subgroup B2 did not grow at 45 ^oC. Subgroup B2 was further divided into 2 groups according to isomers of lactic acid. Subgroup B21 produced L-lactic acid from glucose (4 strains), while subgroup B22 produced DL-lactic acid (23 strains). All strains in subgroup B22 did not produce NH₃ from arginine. One strain (CP8-1) was separated from sub-group B22 and located in subgroup B23 be-cause it hydrolyzed arginine. The distribution of isolated strains among groups and their other general characteristics are shown in Tables 2 and 3. Tables 4 and 5 present the characteristics regarding the acid production from carbohydrates by group A and B strains, respectively.

Table 4. Acid production from carbohydrates by group A strains.

Legend: positive (+), weakly positive (W), negative reaction (-), not determined (ND); numbers in parenthesis indicate the number of strains showing a positive or negative reaction.

¹Data from [1, 2, 7, 9, 19, 24, 26]; ²Data from [1]; ³Data from [25].

Table 5. Acid production from carbohydrates by group B strains.

Legend: positive (+), weakly positive (W), negative reaction (-), not determined (ND); numbers in parenthesis indicate the number of strains showing a positive or negative reaction.

¹Data from [24]; ²Data from [23, 27]; ³Data from [20, 24, 26]; ⁴Data from [24].

Peptidoglycan type of cell walls and isomers of lactic acid

Only subgroup B22 strains contained DAP in the whole cell hydrolysate (Table 3), while the others (subgroup A1, A22, A23, B11, B12, B21, B23 strains) had no DAP.

Subgroup A1, A21, A22, B11, B12, B22, and B23 strains produced DL-lactic acid, while subgroup B21 strains produced L-lactic acid from D-glucose.

Diacetyl production and bacteriocins production

Three strains from subgroup B22 (CP2-3A, CP2-11 and CP3-16) and one from A1 (CP3-11) produced diacetyl, while the other isolates did not.

The inhibition tests against B. cereus and S. aureus showed that five isolates could inhibit the growth of B. cereus (CP1-15, CP2-11, CP3-1, CP7-3, CP10-3) and two of them could also inhibit S. aureus (CP1-15, CP7-3).

These isolates were from subgroups A1 (CP3-1), A22 (CP7-3), and B22 (CP1-15, CP2-11, CP10-3).

Discussion

The isolates were assigned to the genera Lactobacillus (35), Pediococcus (22), and Weissella (8) on the basis of morphological, cultural, biochemical, and physiological characteristics, fermentation type, isomer of lactic acid and 16S rRNA gene sequences. They were grouped at species level on the basis of key phenotypic characteristics and 16S rRNA gene sequences.

Group A1 contained 8 isolates (CP1-8, CP3-1, CP3-8, CP3-9, CP3-10, CP3-11, CP4-6, and CP4-11). The strains in this group were heterofermentative sphere-shaped, produced slime on sucrose, did not grow at 45 ^oC, had no DAP in peptidoglycan, produced DL-lactic acid, and were identified as belonging to genus Weissella. Similarly to the type strain W. confusa ATCC 10881^T, the isolates produced NH₃ from arginine and hydrolyzed esculin, produced acids from D-cellobiose, D-fructose, D-glucose, maltose, D-mannose, salicin, sucrose and xylose, but not from D-melezitose, D-melibiose, raffinose, D-sorbitol, and D-trehalose [2, 7, 9, 19, 24, 26]. Based on 16S rRNA gene sequences of selected isolates, CP3-8 represented 99 % similarity to W. confusa ATCC 10881^T and CP1-8, CP3-9, CP4-6, and CP4-11 represented 98 %, 98 %, 99 %, and 99 % similarities respectively to W. kimchii JCM 12495^T.

Group A21 contained 20 strains (CP1-5, CP1-18, CP7-4, CP7-8, CP11-2, CP11-3, CP11-5, CP11-7, CP11-8, CP11-10, CP11-11, CP11-13, CP11-14, CP11-15, CP12-4, CP13-2, CP13-3, CP13-4, CP13-7, and CP13-11). The strains in this group were homofermentative sphere-shaped, grew at 45 ^oC but not at 50 ^oC. They were negative for catalase activity, nitrate reduction, slime formation from sucrose, acid production, reduction in litmus milk, and had no DAP in peptidoglycan. They all hydrolyzed esculin, and produced acid from D-cellobiose, D-fructose, D-glucose, D-mannose and D-ribose, but failed to produce acid from a-methyl-glucoside, D-melezitose, glycerol, D-mannitol, and D-sorbitol. On the basis of these key characteristics [25], they were identified as P. pentosaceus. CP1-18, CP7-4, and CP11-11 were selected for 16S rRNA gene sequence analysis, and represented 99 %, 98 %, and 98 % similarities respectively to P. pentosaceus ATCC 33316^T.

Group A22 contained 2 strains (CP6-2 and CP7-3). The strains in this group were homofermentative sphere-shaped, and grew at 50 ^oC. They were negative for catalase activity, nitrate reduction, slime formation from sucrose, acid production and reduction in litmus milk, and had no DAP in peptidoglycan. They all hydrolyzed esculin, and produced acid from D-cellobiose, D-fructose, D-glucose, D-mannose, and D-ribose but failed to produce acid from a-methylglucoside, D-melezitose, glycerol, D-mannitol, and D-sorbitol. On the basis of these key characteristics [25], they were identified as P. acidilactici. Based on 16S rRNA gene sequence analysis, CP6-2 and CP7-3 represented 98 % similarities to P. acidilactici DSM 20284^T. 

Group B11 contained 3 strains (CP7-2, CP7-9, and CP13-1). The strains in this group were heterofermentative rod-shaped, grew at 45 ^oC, produced DL-lactic acid and had no DAP in peptidoglycan. Similarly to the type strain L. fermentum ATCC 14931^T, these strains produced acid from D-glucose, D-fructose, D-ribose and sucrose, but failed to produce acid from gluconate, glycerol, and a-methyl-D-glucoside. Based on 16S rRNA gene sequence analysis, CP7-2, CP7-9 and CP13-1 represented 100 %, 100 % and 99 % similarities respectively to L. fermentum ATCC 14931^T.

Group B12 contained 4 strains (CP1-13, CP1-14, CP1-19, and CP6-8). The strains in this group were heterofermentative rod-shaped, and did not grow at 45 ^oC, produced DL-lactic acid and had no DAP in peptidoglycan. All strains had the following characteristics in common with L. brevis ATCC 14869^T and 3 other strains identified as L. brevis by Tanasupawat et al. [24] on the basis of DNA relatedness: negative for acid production and reduction in litmus milk; negative for growth at pH 8.5 and at 6 % NaCl; positive for acid production from L-arabinose, fructose, D-glucose and D-xylose; negative for acid production from D-amygdalin, D-cellobiose, gluconate, glycerol, lactose, D-man-nose, D-mannitol, D-melezitose, D-melibiose, raffinose, L-rhamnose, D-sorbitol, sucrose, and D-trehalose. The two strains selected for 16S rRNA gene sequence analysis, CP1-19 and CP6-8, represented 98 % similarities with L. brevis ATCC 14869^T.

Group B21 contained 4 strains (CP2-3B, CP5-2, CP5-6, and CP5-9). The strains in this group were homofermentative rod-shaped, did not grow at 45 ^oC, had no DAP in peptidoglycan, and produced L-lactic acid from glucose. All strains had the following key characteristics of L. farciminis [6]: positive for NH₃ production from arginine; positive for acid production from D-cellobiose, D-galactose, D-glucose, lactose, D-mannose, salicin, sucrose and D-trehalose; negative for acid production from D-mannitol, D-melibiose, and raffinose; positive for growth at 10 % NaCl. The two strains selected for 16S rRNA gene sequence analysis, CP5-2 and CP5-9, represented 98 % and 99 % similarities respectively to L. farciminis ATCC 29644^T.

Group B22 contained 23 strains (CP1-15, CP1-17, CP1-20, CP2-3A, CP2-10, CP2-11, CP2-16, CP3-16, CP4-5, CP4-12, CP4-16, CP4-17, CP4-18, CP6-3, CP6-10, CP7-5, CP7-7, CP7-10, CP7-12, CP7-13, CP8-4, CP10-2, and CP10-3). The strains in this group were homo-fermentative rod-shaped, did not grow at 45 ^oC, had DAP in peptidoglycan, and produced DL-lactic acid from glucose. All isolates hydrolyzed esculin, but not arginine. They all produced acid from D-cellobiose, D-fructose, D-galactose, D-glucose, D-maltose, D-mannitol, D-mannose, D-ribose, salicin, sucrose and D-trehalose, but not from glycerol. These are the common characteristics with L. plantarum ATCC 14917^T and the other 16 strains identified as L. plantarum by Tanasupawat et al. [20] on the basis of DNA relatedness. The eight strains selected for 16S rRNA gene sequence analysis, CP1-15, CP1-20, CP2-3A, CP3-16, CP6-10, CP7-7, CP8-4, and CP10-3, represented 98 % similarities to L. plantarum ATCC 14917^T.

Group B223 contained one strain, CP8-1. This strain was homofermentative rod-shaped, did not grow at 45 ^oC, had no DAP in peptido-glycan and produced DL-lactic acid from glucose. This strain was removed from group B22 because it hydrolyzed arginine. Similarly to L. sakei ATCC 15521^T, CP8-1 produced acid from L-arabinose, D-cellebiose, D-fructose, D-glucose, gluconate, D-melibiose, D-ribose and sucrose, but failed to produce acid from D-mannitol, D-melezitose, raffinose and D-sorbitol. The 16S rDNA sequence analysis of this strain showed 99 % similarity to L. sakei ATCC 15521^T. Fig. 1 shows a phylogenetic tree based on 16S DNA sequences of type strains and of representative strains of each group.

Most lactic acid bacteria isolated in this study were assigned to P. pentosaceus (31 %) and L. plantarum (35 %). L. pentosus and L. plantarum that contain meso-diaminopimelic acid in the cell wall were previously reported to be the predominant rod-shaped LAB, and P. pentosaceus strains were the major coccal bacteria in other fermented Thai foods, e.g. fish cake, sweetened rice, fermented rice noodle and pickle [21]. Table 6 summarizes the identification of isolates and their distribution in Thai traditional fermented sausages. It is noteworthy that L. plantarum was distributed in at least 8 (of total 12) samples and P. pentosaceus in 5 (of total 12) samples used in this study. On the other hand, Weissella sp., P. acidilactici, L. fermentum, L. brevis, L. farciminis and L. sakei were isolated from much fewer samples.

Table 6. Identification of isolates and their distribution in Thai traditional fermented sausages.

Previous studies reported the isolation of L. pentosus, L. plantarum, L. fermentum, P. pentosaceus, and Enterococcus hirae from “Sai-krog-prieo”, and of L. plantarum and Enterococcus sp. from “mum” [21, 22]. This study first reports the isolation of W. cibaria/kimchii, W. confusa, L. brevis, and L. farciminis, from “Sai-krog-prieo”, and P. pentosaceus, P. acidilactici, L. fermentum, L. brevis, and L. sakei from “mum”.

Certain strains from this study were found to produce diacetyl and bacteriocins. B. cereus and S. aureus were selected as test pathogens for preliminary bacteriocin screening, while further studies on activity spectrum and bacteriocin characterization, i.e., minimum inhibitory concentration, thermostability, synergism of each purified bacteriocin, are being pursued at our laboratory.  

Acknowledgements. We gratefully acknowledge the support of Thailand Research Fund and NRCT-JSPS for the research grants. We thank the Faculty of Pharmaceutical Sciences, Chulalongkorn University and Mahidol University-Osaka University Collaborative Re-search Center for providing research facilities. Special thanks to Mr. Amnat Pakdeeto and Mr. Veerapon Chavasirikunton for their technical assistances and to Prof. Watanalai Panbangred and Assoc. Prof. Nachol Chaiyaratana for their discussions on 16S DNA sequence analysis and the phylogenetic tree construction.

References

1. Choi, H.-J., C.-L. Cheigh, S.-B. Kim, J.-C. Lee, D.-W. Lee, S.-W. Choi, J.-M Park, Y.-R. Pyun, 2002. Int. J. Syst. Evol. Microbiol., 52, 507-511.
2. Collins, M.D., J. Samelis, J. Metaxopoulos, S. Wallbanks, 1993. J. Appl. Bacteriol., 75, 595-603.
3. De Man, J.C., M. Rogosa, M.E. Sharpe, 1960. J. Appl. Bacteriol., 23, 130-135.
4. De Rijk, P., J.-M. Neefs, Y. Van de Peer, R. De Wachter, 1992. Nucleic. Acids Res., 20, 2075-2089.
5. Felsenstein, J., 1985. Evolution, 39, 783-791.
6. Hammes, W.P., R.F. Vogel, 1995. The genus Lactobacillus. In: The Genera of Lactic Acid Bacteria, B.J.B Wood, W.H. Holzapfel (Eds), London: Blackil Academic & Professional, 19-54.
7.  Hammes, W.P., N. Weiss, W. Holzapfel, 1992. The genera Lactobacillus and Carnobacterium. In: The Prokaryotes, 2^nd ed., Vol. II, A. Balows, H.G. Trüper, M. Dworkin, W. Harder, K.H. Schleifer (Eds), New York: Springer-Verlag, 1536-1594.
8. Hucker, G.J., H.J. Conn, 1923. Method of gram staining. Technical Bulletin 93, New York State Agricultural Experiment Station, Ithaca, 3-37.
9.  Kandler, O., N. Weiss, 1986. Genus Lactobacillus. Beijerinck. 1901. 212^AL. In: Bergey’s Manual of Systematic Bacteriology, Vol. 2, P.H.A. Sneath, N.S. Mair, M.E. Sharpe, J.G. Holt (Eds), Baltimore: Williams & Wilkins, 1208-1234.
10. Kimura, M., 1980. J. Mol. Evol., 16, 111-120.
11.  Komagata, K., K. Suzuki, 1987. Lipid and cell-wall analysis in bacterial systematics. In: Methods in Microbiology, Vol. 19, R.R. Colwell, R. Grigorava, London: Academic Press, 161-207.
12. Leroy, F., B. Degeest, V.L. De, 2002. Int. J. Food Microbiol., 73, 251-259.
13. Mattessich, J., J.R. Cooper, 1989. Anal. Biochem., 180, 349-350.
14. Nilsson, W.B., R.N. Paranjype, A. De Paola, M. S. Strom, 2003. J. Clin. Microbiol., 41, 442-446.
15. Okada, S., T. Toyoda, M. Kozaki, 1978. Agric. Biol. Chem. 42, 1781-1783.
16. Phalip, V., P. Schemitt, C.A. Dives, 1994. J. Basic Microbiol., 34, 277-280.
17. Reid, G., 1999. Appl. Env. Microbiol., 65, 3763-3766.
18. Saitou, N., M. Nei, 1987. Mol. Biol. Evol., 4, 406-425.
19. Schillinger, U., W. Holzapel, O. Kandler, 1989. Syst. Appl. Microbiol., 12, 48-55. 
20. Tanasupawat, S., T. Ezaki, K. Suzuki, S. Oka-da, K. Komagata, M. Kozaki, 1992. J. Gen. Appl. Microbiol., 38, 121-134.
21. Tanasupawat, S., K. Komagata, 1995. World J. Microbio. & Biotechnol., 11, 253-256.
22. Tanasupawat, S., K. Komagata, 2001. Lactic acid bacteria in fermented foods in Southeast Asia. In: Microbial Diversity in Asia: Technology and Prospects, B. H. Nga, H. M. Tan, K. Suzuki (Eds), Singapore: World Scientific Publishing Co. Pte. Ltd., 252.
23. Tanasupawat, S., S. Okada, K. Komagata, 1998. J. Gen. Appl. Microbiol., 44, 193-200.
24. Tanauspawat, S., S. Okada, K. Suzuki, M. Kozaki, K. Komagata, 1993a. Bull. JFCC, 9, 65-78.
25. Tanauspawat, S., S. Okada, K. Suzuki, M. Kozaki, K. Komagata, 1993b. Int. J. Syst. Bacteriol. 43, 860-863.
26. Tanauspawat, S., O. Shida, S. Okada, K. Komagata, 2000. Int. J. Syst. Evol. Microbiol., 50, 1479-1485.
27. Tanasupawat, S., J. Thongsanit, S. Okada, K. Komagata, 2002. J. Gen. Appl. Microbiol., 48, 201-209.
28. Thompson, J.D., T.J. Gibbons, F. Plewniak, F. Jeanmougin, D.G. Higgins, 1997. Nucleic Acids Res., 25, 4876-4882.
29. Van de Peer, Y., S. Nicola¿, P. De Rijk, R. De Wachter, 1996. Nucleic Acids Res., 24, 86-91.
30. Whittenbury, H., 1963. J. Gen. Appl. Microbiol., 32, 375-384.
31. Yin, L.-J., C.-W. Wu, S.-T. Jiang, 2003. J. Agric. Food Chem., 51, 1071-1076.

 Copyright 2005 - National Bank for Industrial Microorganisms and Cell Cultures - Bulgaria

The following images related to this document are available:

Photo images