Electronic Journal of Biotechnology Universidad Católica de Valparaíso ISSN: 0717-3458 Vol. 10, Num. 3, 2007, pp. 473 - 480

Electronic Journal of Biotechnology, Vol. 10, No. 3, July 15, 2007, pg. 473 - 480

TECHNICAL NOTE

Isolation of simple sequence repeats from groundnut

Chuan Tang Wang*¹, Xin Dao Yang² , Dian Xu Chen³ , Shan Lin Yu⁴ , Guang Zhen Liu⁵ , Yue Yi Tang⁶ , Jian Zhi Xu⁷

¹Shandong Peanut Research Institute Qingdao 266100 P R China Tel: 86 532 87626662 Fax: 86 532 87626832 E-mail: chinapeanut@126.com
²Shandong Peanut Research InstituteQingdao 266100 P R China Tel: 86 532 88433679 Fax: 86 532 87626832 E-mail: smdkrdc@126.com
³Shandong Peanut Research InstituteQingdao 266100 P R China Tel: 86 532 87626723 Fax: 86 532 87626832 E-mail: Chenzhao126@sina.com
⁴Shandong Peanut Research InstituteQingdao 266100 P R China Tel: 86 532 87626830 Fax: 86 532 87626832 E-mail: rice407@sohu.com
⁵Shandong Peanut Research InstituteQingdao 266100 P R China Tel: 86 532 88411241 Fax: 86 532 88411241 E-mail: wangzhuo1995@126.com
⁶Shandong Peanut Research InstituteQingdao 266100 P R China Tel: 86 532 87626662 Fax: 86 532 87626832 E-mail: tangyueyi0597@sina.com
⁷Shandong Peanut Research Institute Qingdao 266100 P R China Tel: 86 532 88411707 Fax: 86 532 87626832 E-mail: Tsingtao2008@126.com 

*Corresponding author

Financial support: The research was supported in part by grants from China Natural Science Foundation (Grant No. 30300224), China Ministry of Science and Technology (Grant No. 2002CCC03200, Grant No. 2006AA10A114), and New and High Technology Innovation Foundation of Shandong Academy of Agricultural Sciences (Grant No. 2006 YCX013).

Code Number: ej07046

Abstract

SSRs have proved to be the most powerful tool for variety identification in groundnut of similar origin, and have much potential in genetic and breeding studies. To facilitate SSR discovery in groundnut, we proposed a highly simplified SSR isolation protocol based on multiple enzyme digestion/ligation, mixed biotin-labeled probes and streptavidin coated magnetic beads hybridization capture strategy. Of the 272 colonies randomly picked for sequencing, 119 were found to have unique SSR inserts.

Keywords: groundnut, isolation, simple sequence repeat.

Abbreviations:

AFLP: amplified fragment length polymorphism
MW: molecular weight
PCR: polymerase chain reaction
SDS: sodium dodecyl sulfate
SSR: simple sequence repeat

Article

Groundnut or peanut (Arachis hypogaea L.), is an important crop worldwide, distributed across the vast area in tropical, subtropical and temperate zones. It is a valuable source of edible oil and protein for human beings, and of fodder for livestock. In contrast to its apparent diversified variations in traits, its genetic variations at molecular level as detected by RAPD, RFLP, and SSR analysis, proved to be unexpectedly low (Halward et al. 1993; Krishna et al. 2004). In that case, the genetic linkage maps published were constructed using wild Arachis species (Halward et al. 1993; Burow et al. 2001; Moretzsohn et al. 2005).

Several workers (Hopkins et al. 1999; Gao et al. 2003; Ferguson et al. 2004; Moretzsohn et al. 2004) have reported groundnut SSR primers developed either based on traditional library construction and screening or by exploiting an AFLP pre-amplification protocol, with variable rate of success. Yang et al. (2005) identified 24 new groundnut SSR-containing sequences by means of GenBank inquiry. To facilitate SSR marker development in groundnut, we presented a highly simplified SSR DNA isolation protocol with good results.

DNA was extracted from leaves of field-grown groundnut plants of 24-3, a hybrid derivative of Arachis hypogaea L. x A. glabrata Benth PI262801, following a modified CTAB method as described earlier (Wang et al. 2004). DNA digestion and ligation mixture (60 µl) containing 10 x NEBuffer4 6 µl, BSA (100x) 0.6 µl, groundnut genomic DNA 0.6 µg, AP11/AP12 adaptor 15 pmol (AP11: 5'→3' CTCTTGCTTAGATCTGGACTA, AP12:5'→3' pTAGTCCAGATCTAAGCAAGAGCACA), 10 mM ATP 6 µl, Dra I (NEB) 0.5 µl, Hae III (NEB) 1 µl, Rsa I (NEB) 0.5 µl, PshA I (NEB) 0.5 µl and T4 DNA Ligase (NEB cat # M0202T) 2 µl, was incubated at 37ºC overnight, and at 80ºC for 20 min to de-activate the enzymes. Ten microliters of digestion and ligation product were pre-amplified using 3 µl of AP11 primer (10 µM) in a volume of 50 µl, and the PCR profile was 72ºC for 2 min, 94ºC for 2 min, and 10 cycles of 1 min at 94ºC, 1 min at 55ºC and 2 min at 72ºC, and a final extension step of 72ºC for 10 min.

The hybridization mixture (30 µl), made up of 100 ng of the pre-amplification product, 6XSSC, 0.1% SDS, and 200 ng each of 5' biotinylated (TA)₃₀, (CA)₂₀, (GA)₂₀, (AGA)₁₅, (TGA)₁₅, (ACA)₁₅ (Sangon Ltd), was subjected to 5 min of denaturation at 95ºC and 1 hr of re-naturation at 60ºC. Two hundred micrograms of streptavidin-coated paramagnetic beads (Promega), previously equilibrated with 6xSSC for 3 times and 6xSSC, 0.1% SDS for 1 time, were then added to the mixture. The mixture was incubated at 60ºC for 15 min with gentle agitation at 5 min intervals. Liquid was removed using a magnetic separation stand (Promega). Beads were washed with gentle agitation with 300 µl of 6xSSC, 0.1% SDS at room temperature for 15 min for 2 times, with pre-warmed 6xSSC, 0.1% SDS (60ºC) at 60ºC for 15 min for 2 times, and then with 300 µl of 6xSSC at room temperature for 15 min for 2 times to remove SDS. After removal of final wash, captured DNAs were eluted from the beads with addition of 200 µl of T.E preheated to 95ºC, gentle flicking of the Eppendorf tube, and incubation at 95ºC for 10 min. With the aid of the magnetic stand, eluted DNAs in T.E buffer were quickly transferred to an aseptic tube in ice bath, and then desalted at 4ºC using a Millipore Microcon YM-100 column according to producer's recommendation. The probes in the captured DNAs were also removed during this process, so were the ssDNAs with MW lower than 300 nt.

The resultant DNAs were amplified using primer AP11, purified and ligated into a pCF-T vector (Tiangen Biotech). Chemically competent cells of TOPO 10 were utilized in heat-shock transformation. Length of inserts was determined using a colony PCR procedure involving heat treatment of white colonies with TTE buffer. DNA sequence was analyzed on an ABI 3730XL sequencer using the M13 forward/reverse primer. After removal of the sequence of vector and adaptor and exclusion of redundant sequences, SSRs in the inserts were identified by exploiting the SSR Hunter and Tandem Repeat Finder search tools.

Agarose electrophoresis of pre-amplification product showed that multiple enzyme digestion/ligation procedure produced DNA fragments of expected size (200-around 1000 bp) (Figure 1). PCR product of captured DNAs was in the similar MW range (Figure 1). Sixty colonies were randomly picked for colony PCR using AP11 primer. All of them harbouring plasmids with inserts of expected size (Figure 1 and Figure 2).

Plasmids were extracted from the colonies and inserts sequenced using M13 forward/reverse primer. Of the 272 colonies for sequencing, 259 were non-redundancy sequences, and 119 were found to have unique SSR inserts (Table 1). All of the six probes used could be directly related to these sequences; the (cgc) 4 SSR was an only exceptional case. The ratio of non-redundant SSR inserts was 43.7%. Although it may not be the highest in groundnut SSR isolation, due to the judicious choice of restriction enzymes, and a probe removal step for uprooting probe-primed PCR, most of these SSRs identified were found to possess flanking sequences needed for primer design; we were able to design 123 “good” primer pairs for further evaluation. In Hopkins's report, 66 (55.0%) out of the 120 sequenced “positive” clones had SSRs, but only 26 (21.7%) primer pairs could be designed, where both the occurrence of short tandem repeats (<6 core unit) and the close proximity of the SSR to the end of insert DNA limited the ability to design primers for the majority of the SSRs identified (Hopkins et al. 1999). Gao et al. (2003) identified 14 (5.5%) unique SSR-containing sequences in 256 clones. He et al. (2003) sequenced 401 randomly picked clones resulting from AFLP pre-amplification based protocol, 83 (20.7%) of which were unique SSRs, and 56 (14.0%) primer pairs were designed. Moretzsohn et al. (2004) pre-screened the clones before sequencing using SSR-anchored PCR strategy and found 162 of the 750 clones had SSRs. There were 91 unique sequences, but only 67 were suitable for primer design (41.4% of positive clones). Ferguson et al. (2004) identified 348 (21.3%) SSRs by sequencing 1,627 clones, merely 226 (13.9%) primers could be designed.

In contrast to previous reported SSR isolation protocols, our simplified protocol utilized 4 enzymes to cut groundnut DNA into ideally sized fragments which were ligated to adaptors in a single tube. The present SSR enrichment protocol adopted a multiple enzyme digestion/ligation procedure apparently similar to AFLP pre-amplification based protocol, but the product in our protocol was in the range of 200-1000 bp, whereas in groundnut EcoR I/Mse I AFLP protocol, the pre-amplification product was generally between 70 and 500 bp. Too short DNA sequences in the latter case may increase the possibility of lack of adequate flanking sequences. With the advance in sequencing facility and technology, the number of base pairs of DNA readable in a single sequencing reaction tends to be longer and longer, and DNA inserts of ~1000 bp do not necessarily mean more cost.

It can be seen from the Figure 3 that ct/ag repeat motif had the highest frequencies, followed by ga/tc, ttc/gaa and ca/tg. Indeed, ct/ag repeat was reported to be rich in other plant species, and was the most frequently dispersed SSRs of groundnut in He's report (He et al. 2003). The results to some extent may reveal the relative abundance of different repeat motifs as well as the ease of capture.

The copy number of the SSR core sequences was also highly variable. SSRs, even for 3-nucleotide core sequences, with copy number higher than 40 were not strange. The number of repeats may exceed 80.

In the present study, of the 123 newly designed primer pairs tested in 12 peanut varieties/lines mainly bred in Shandong province, China, only 44 (35.8%) produced polymorphic bands (Huang et al. 2006). Despite the fact that several hundreds of SSRs have been isolated from groundnut, only a small portion of them showed polymorphic in the cultivated groundnut, far from the need for map construction let alone QTL mapping. Strengthening groundnut SSR development is absolutely necessary. Compared to previous protocols reported in groundnut, the present protocol was efficient, time-saving and easy to follow. In all previous reports without exceptions, the cultivated groundnut was the only plant material used to isolate groundnut SSRs; in this study, a hybrid derivative was exploited instead. Considering the polyploidy nature of the groundnut crop and frequent occurrence of multiple banding patterns in groundnut SSR analysis, use of the inter specific hybrid derived material makes it possible to isolate SSRs originated from both cultivated and wild groundnut.

• BUROW, Mark D.; SIMPSON, Charles E.; STARR, James L. and PATERSON, Andrew H. Transmission genetics of chromatin from a synthetic amphidiploid to cultivated peanut (Arachis hypogaea L.): broadening the gene pool of a monophyletic species. Genetics, October 2001, vol. 159, no. 2, p. 823-837.
• FERGUSON, M.E.; BUROW, M.D.; SCHULZE, S.R.; BRAMEL, P.J.; PATERSON, A.H.; KRESOVICH, S. and MITCHELL, S. Microsatellite identification and characterization in peanut (Arachis hypogaea L.). Theoretical and Applied Genetics, April 2004, vol. 108, no. 6, p. 1064-1070. [CrossRef]
• GAO, G.O.; HE, G.-H. and LI, Y.-R. Microsatellite enrichment from AFLP fragments by magnetic beads. Acta Botanica Sinica, November 2003, vol. 45, no. 11, p. 1266-1269.
• HALWARD, T.; STALKER, H.T. and KOCHERT, G. Development of an RFLP linkage map in diploid peanut species. Theoretical and Applied Genetics, November 1993, vol. 87, no. 3, p. 379-384. [CrossRef]
• HE, Guohao; MENG, Ronghua; NEWMAN, Melanie; GAO, Guoqing; PITTMAN, Roy N. and PRAKASH, C.S. Microsatellites as DNA markers in cultivated peanut (Arachis hypogaea L.). BMC Plant Biology, April 2003, vol. 3, p. 3. [CrossRef]
• HOPKINS, M.S.; MITCHELL, S.E.; CASA, A.M.; WANG, T.; DEAN, R.E.; KOCHERT, G.D. and KRESOVICH, S. Discovery and characterization of polymorphic simple sequence repeats (SSRs) in peanut. Crop Science, July-August 1999, vol. 39, no. 4, p. 1243-1247.
• HUANG, Xinyang; WANG, Chuantang; YANG, Xindao and XU, Jianzhi. Analysis of DNA polymorphism in peanut cultivars using new microsatellite markers. Chinese Agricultural Science Bulletin, 2006, vol. 22, no. 10, p. 44-48.
• KRISHNA, Girish Kumar; ZHANG, Jinfa F.; BUROW, Mark; PITTMAN, Roy N.; LU, Yingzhi; PUPPALA, Naveen and DELIKOSTADINOV, Stanko G. Genetic diversity analysis in Valencia peanut (Arachis hypogaea L.) using microsatellite markers. Cellular and Molecular Biology Letters, 2004, vol. 9, no. 4a, p. 685-697.
• MORETZSOHN, Marcio de Carvalho; HOPKINS, Mark S.; MITCHELL, Sharon E.; KRESOVICH, Stephen; VALLS; Jose Francisco M. and FERREIRA, Marcio Elias. Genetic diversity of peanut (Arachis hypogaea L.) and its wild relatives based on the analysis of hypervariable regions of the genome. BMC Plant Biology, July 2004, vol. 4, p. 11. [CrossRef]
• MORETZSOHN, M.C.; LEOI, L.; PROITE, K.; GUIMARÃES, P.M.; LEAL-BERTIOLI, S.C.; GIMENES, M.A.; MARTINS, W.S.; VALLS, J.F.M.; GRATTAPAGLIA, D. and BERTIOLI, D.J. A microsatellite-based, gene-rich linkage map for the AA genome of Arachis (Fabaceae). Theoretical and Applied Genetics, October 2005, vol. 111, no. 6, p. 1060-1071. [CrossRef]
• WANG, Chuan-Tang; YANG, Xin-Dao; CHEN, Dian-Xu. DNA molecular markers in peanut. I. Developing a technical protocol for peanut AFLP assays and screening for highly polymorphic parents for mapping. Journal of Peanut Science, 2004, vol. 33, no. 4. p. 5-10.
• YANG, Xin-Dao, WANG, Chuan-Tang; CHEN, Dian-Xu; ZHANG, Jian-Cheng; XU, Jian-Zhi and LIU, Guang-Zhen. Simple sequence repeats in cultivated peanut as reveals by GenBank inquiry. Journal of Peanut Science, 2005, vol. 34, no. 2, p. 14-16.

Note: Electronic Journal of Biotechnology is not responsible if on-line references cited on manuscripts are not available any more after the date of publication.
Supported by UNESCO / MIRCEN network

The following images related to this document are available:

Photo images