Journal of Postgraduate Medicine Medknow Publications and Staff Society of Seth GS Medical College and KEM Hospital, Mumbai, India ISSN: 0022-3859 EISSN: 0972-2823 Vol. 56, Num. 3, 2010, pp. 201-205

Journal of Postgraduate Medicine, Vol. 56, No. 3, July-September, 2010, pp. 201-205

Case Report

A t (11; 22) (p13; q12) EWS-WT 1 positive desmoplastic small round cell tumor of the maxilla: An unusual case indicating the role of molecular diagnosis in round cell sarcomas

Rekhi B¹ , Basak R² , Desai SB^1,2 , Jambhekar NA¹

¹ Department of Pathology, Tata Memorial Center, Dr. E.B. Road, Parel, Mumbai,
² Department of Molecular Pathology Advanced Center for Treatment, Research and Education in Cancer, Kharghar, Navi Mumbai, India

Correspondence Address: Dr. Bharat Rekhi, Department of Pathology, Tata Memorial Center, Dr. E.B. Road, Parel, Mumbai, India, rekhi.bharat@gmail.com

Date of Submission: 26-Oct-2009
Date of Decision: 10-Mar-2010
Date of Acceptance: 14-Mar-2010

Code Number: jp10055

PMID: 20739766

DOI: 10.4103/0022-3859.68628

Abstract

Keywords: Desmoplastic small round cell tumor, head and neck sarcomas, maxillary tumors, molecular diagnosis

Introduction

Desmoplastic small round cell tumor (DSRCT) is a small round cell tumor of uncertain histogenesis, characterized by stromal desmoplasia, polyphenotypic differentiation and a specific t (11; 22) (p13; q12) translocation. It shows male preponderance; peak incidence in third decade of life and abdominal cavity as its commonest site of occurrence. ^[1] Only isolated cases have been documented, even within series of a DSRCT, at uncommon sites like the head and neck region, limbs and brain, where the index of suspicion for this tumor is exceedingly low. ^[2],[3],[4] Herein, we present a rare case of a DSRCT in the maxilla of a young man, who was initially diagnosed with a primitive neuroectodermal tumor (PNET), based on immunohistochemical (IHC) results. On molecular analysis with sequencing results, the case was confirmed as a DSRCT. The importance of presenting this unusual case is to highlight the value of molecular analysis in round cell sarcomas, especially when IHC results are overlapping. Further, exact categorization of round cell tumors has a therapeutic relevance.

Case Report

A 25-year-old young man presented with repeated left sided nasal blockage accompanied with intermittent bloody nasal discharge over 6 months duration. There was no significant past medical or family or traumatic history. Imaging findings revealed an extensive mass in the maxilla extending into the nasopharynx for which the patient underwent a transpalatal excision, elsewhere that was diagnosed as a primitive neuroectodermal tumor (PNET). His symptoms persisted and he presented to us with a recurrence after 3 months. On clinical examination, his general condition was good. There were no palpable lymph nodes or organomegaly. The outside paraffin block was submitted for review. Conventional hematoxylin and eosin (H and E) stained microsections were prepared and further, paraffin sections were subjected to immunohistochemical analysis (IHC), followed by molecular analysis.

Immunohistochemistry

Immunohistochemistry (IHC) was performed on formalin-fixed, paraffin-embedded tissue using polymer technique (Biocare Med. MACH2 Universal polymer detection). The various antibodies used were vimentin (monoclonal, 1: 50, Dako, Produkionsveg, Glostrup, Denmark), MIC2/CD99 (monoclonal, 12E7 1: 100, Dako), synaptophysin (polyclonal, 1: 100, Dako), chromogranin (polyclonal, 1: 50, Dako), CD56 (monoclonal, 1: 100, BBS/NC/H14, Dako), cytokeratin (CK) (monoclonal, 1: 100, Dako), S-100 (polyclonal, 1: 300. Dako), epithelial membrane antigen (EMA) (monoclonal, 1: 100, Dako), BCL2 (1: 50, monoclonal, Dako), -FLI-1 (1:75, polyclonal, Biocare Med. USA), desmin (monoclonal, 1: 50, Dako), -Myo D-1 (monoclonal, 1: 20, Dako), Myogenin (1: 50, Novocastra, UK) and (-WT-1 monoclonal, 1: 100, Dako).

Molecular analysis

Reverse transcription-PCR analysis

Total RNA was isolated from formalin-fixed paraffin-embedded tissue section using Recover All Total Nucleic Acid Isolation kit (Ambion, USA). Extracted RNA was treated with RNase-free DNase I before cDNA preparation. cDNA was prepared using Superscript First strand synthesis kit (Invitrogen). Briefly, 500 ng of total RNA was reverse transcribed into cDNA using random hexamers at 42 ^o C for 50 min followed by 70 ^o C for 15 min. Synthesized cDNA was treated with RNase H for 20 min at 37 ^o C to remove the RNA-DNA hybrids. Two microliter from the reaction was PCR amplified using EWS 22.3 forward primer (5′-TCC TAC AGC CAA GCT CCA AGT C-3′) and WT1 reverse primer (5′-GCC ACC GAC AGC TGA AGG GC-3′) in a 20 ml reaction volume containing 10 ml pmol each of the forward and reverse primer, 10 ml 2Χ PCR master mix (Qiagen, Germany). PCR conditions were as follows: 35 cycles of 94°C for 30 s, 65°C for 30 s and 72°C for 30 s. Amplified PCR products were checked in 10% polyacrylamide gel and stained with silver nitrate. Two positive controls (-EWS-WT1-259bp and 268bp PCR product cloned into pTZ57R/T vector) and one water only (no cDNA) negative control were included in each run. To check the quality and integrity of the cDNA, FKHR was amplified as a housekeeping gene (FKH-F: 5′ CAT CCC CTT CTC CAA GAT CA 3′; FKH-R: 5′ GCT GCC AAG AAG AAA GCA TC 3′).

Sequencing

The PCR products were run in 2% agarose gel, DNA was extracted and sequencing was done in 3100 Avant™ Genetic Analyzer (Applied Biosystems, USA) using pUC/M13 primer.

Laboratory investigations

The routine laboratory investigations were within normal limits at the time of presentation.

Radiological findings

Initial computed tomography (CT) scan showed a 4.5 Χ 3.7 Χ 4.4 cm sized heterogeneously enhancing mass in the left maxillary sinus extending into the left ethmoid sinus, sphenoid sinus, right posterior ethmoidal air cells, the left orbit and infratemporal fossa. Isolated mass extended into the nasal cavity through the choana into nasopharynx. Superiorly, the mass was seen destroying orbital wall and abutting rectus muscles. Posteriorly, it was seen extending into infratemporal fossa [Figure - 1].

At the time of recurrence, on bone scan, there was an increased tracer uptake in the left maxillary region consistent with the primary site. No skeletal metastasis was noted in the entire body.

Histopathological findings

Conventional hematoxylin and eosin (H and E) stained sections showed a malignant round cell tumor with tumor cells in sheets separated by septae containing blood vessels. Cells displayed high nucleo/cytoplasmic (N/C) ratio, scanty cytoplasm, exhibited uniform chromatin and focal prominent nucleolization. There were no acinar formations, mucinous areas or any 'tadpole-shaped' cells. There were no mitoses or necrosis in the limited biopsy material [Figure - 2].

On immunohistochemistry (IHC), tumor cells were diffusely positive for vimentin, MIC2, FLI1 and focally for CD56 [Figure - 3] and [Figure - 4], while negative for cytokeratin (CK), epithelial membrane antigen (EMA), desmin, myogenin, Myo-D1, WT-1, synaptophysin, chromogranin and neuron specific enolase (NSE).

Diagnosis of a primitive neuroectodermal tumor (PNET) was offered.

The metastatic work-up was negative. Bone marrow was uninvolved.

In view of uncommon site, molecular analysis was performed for various round cell sarcomas, including Ewings sarcoma, monophasic synovial sarcoma and a DSRCT.

Molecular results

RT-PCR showed positive results for EWS-WT1 and negativity for EWS-FLI1 and SYT-SSX (1 and 2) [Figure - 5].

Sequencing data

PT:GCCACCGACAGCTGAAGGGCTTTTCACTTGTTTTACCTGTATGAGTCCTGGTGTGGGTCT

WT1:GCCACCGACAGCTGAAGGGCTTTTCACTTGTTTTACCTGTATGAGTCCTGGTGTGGGTCT

PT:TCAGGTGGTCGGACCGGGAGAACTTTCGCTGACAAGTTTTACACTGGAATGGTTTCACAC

WT1:TCAGGTGGTCGGACCGGGAGAACTTTCGCTGACAAGTTTTACACTGGAATGGTTTCACAC

PT:CTGTATGTCTCCTTTGGTGTCTTTTGAGCTGGTCTGAACGAGAAAACCTTCGTTCACAGT

WT1:CTGTATGTCTCCTTTGGTGTCTTTTGAGCTGGTCTGAACGAGAAAACCTTCGTTCACAGT

PT: CCTTGAAGTCACACTGGTATGGTTTCTCAC

WT1: CCTTGAAGTCACACTGGTATGGTTTCTCAC

PT:ACTCTGCTGCCCGTAGCTGCTGCTCTGTTGGCTTATTGACTTGGAGCTTGGCTGTAGGA

EWS:CTCTGCTGCCCGTAGCTGCTGCTCTGTTGGCTATATTGACTTGGAGCTTGGCTGTAGGA

Remark: The underlined parts are the two primers. PT: Patients' sequence.

Management

The patient was induced on the chemotherapy (CT) protocol for Ewing's family tumors (EFT) 2001 including drugs like vincristine, ifosfamide, etoposide, Adriamycin, along with post-induction external beam radiotherapy (EBRT) that he tolerated well. Presently he is on maintenance chemotherapy (CT) and follow-up. He developed febrile neutropenia for which he was treated. He was also offered adjuvant RT.

Discussion

There is limited documentation of a DSRCT in the head and neck region ^{[1],[2],[3],[4],[5]} [Table - 1]. Still rare is occurrence of this tumor in the maxilla, as noted in our case. ^[3] A low index of suspicion and unavailability of molecular analysis can add to the rarity of this tumor at unusual locations. The present case was referred with diagnosis of a PNET with IHC results. Similar results were obtained on review at the time when the patient presented to us with a tumor recurrence.

A DSRCT generally exhibits polyphenotypic expression, including positivity for epithelial markers, muscle markers and neuroendocrine markers, along with variable amount of WT-1 positivity. ^[1] However, the polyphenotypic expression was lacking in our case with retained expression of MIC2, FLI-1 and CD56 that was more in keeping with a PNET. However, this IHC profile can also be seen in a DSRCT. ^[6] Lack of 'tadpole-shaped' cells with desmin, myo-D1 and myogenin negativity ruled out a rhabdomyosarcoma. Negative synaptophysin and chromogranin with retained expression of MIC2 and FLI-1 negated diagnosis of an olfactory neuroblastoma. In view of uncommon location, lack of desmoplasia on histopathology and aforementioned IHC profile, diagnosis of a DSRCT was less likely to be considered, initially. However on molecular analysis, the tumor exhibited the characteristic t(11; 22) (p13; q12) translocation with EWS-WT-1 positivity for a DSRCT that was further confirmed with sequencing results. The other transcripts for PNET i.e. EWS-FLI1 and round cell synovial sarcoma i.e. SYT-SSX were negative. Variability in expression of IHC markers in a DSRCT has been observed in earlier series. ^[2],[3] However, translocation and functional fusion resulting in EWS-WT1 transcript is a definite feature of a DSRCT. ^[2],[3] The sensitivity of molecular methods has been found to be very high as 98% and 96%, respectively in two different studies, with a contrastingly low value for IHC markers. ^[1],[3]

Only a single case of a DSRCT has been identified at a similar site, as in the present case, in a series of 32 DSRCTs documented by Lae et al. ^[3] Presence of a DSRCT at sites other than the classical abdominal cavity argues against the hypothesis that it is histologically related to mesothelium, in view of WT-1 positivity, as initially thought. ^[3],[7] The possibility of metastasis was ruled out in the present case with negative clinical 'work up'.

The value of exact diagnosis of a DSRCT has therapeutic and prognostic relevance, as noted in this present case. Among round cell tumors, while a non-Hodgkin's lymphoma of bone and soft tissue sites is treated with a specific CT and RT, a rhabdomyosarcoma and a PNET are treated with differing CT regimes. ^[8],[9],[10] A DSRCT is managed with a CT similar to a PNET i.e. EFT 2001. Further, in view of its relatively aggressive disease course, a multimodality therapy is recommended for a classical DSRCT that includes debulking surgery, CT and RT. ^[11] Our case was managed initially with surgery, followed by CT, along with adjuvant RT.

The case is presented in view of its rare occurrence and also suggests the value of molecular analysis in round cell sarcomas at unusual sites, especially when IHC results are apparently unequivocal for diagnosis of a PNET. Further, a final diagnosis of a DSRCT in the present case reflects the predictive and prognostic value of objectively identifying this malignant round cell tumor.

References

Copyright 2010 - Journal of Postgraduate Medicine

The following images related to this document are available:

Photo images