 |
| About Bioline | All Journals | Testimonials | Membership | News |
|
||||||
|
||||||
Indian Journal of Medical Microbiology, Vol. 26, No. 4, October-December, 2008, pp. 372-374 Brief Communication High rate of mutation K103N causing resistance to nevirapine in Indian children with acquired immunodeficiency syndrome Sehgal S, Pasricha N, Singh S Department of Immunopathology, Postgraduate Institute of Medical Education and Research, Chandigarh - 160 012 Date of Submission: 17-Aug-2007 Code Number: mb08113 Abstract In north India the number of paediatric cases with acquired immunodeficiency syndrome (AIDS) is on the rise. Most drug combinations used for treatment of AIDS incorporate nevirapine, resistance to which develops very fast if given singly or because of unplanned interruptions. This paper investigates presence of mutations at codon 103 and codon 215 of the HIV pol gene causing resistance to nevirapine and zidovudine (AZT) respectively in 25 children with AIDS. Mutations T215Y and K103N were detected by a nested cum amplification refractory mutation system polymerase chain reaction (ARMS PCR) and the results were confirmed by direct sequencing in five randomly selected cases. Nineteen patients had received nevirapine containing regimen and six were drug naive. Mutation K103N was observed in 56% (14/25) of the children while mutation T215Y was found in none. Two of the six drug naοve children also showed K103N mutation. Thus, Indian children drug naοve or treated with nevirapine containing regimens show a high rate of mutation conferring resistance to nevirapine which calls for a judicious use of nevirapine both in antenatal and postnatal setting.Keywords: Children with AIDS, mutation K103N, nevirapine. In the developed world, antiretroviral (ARV) therapy has revolutionized the quality of life and longevity in patients with acquired immunodeficiency syndrome (AIDS) [1] but the emergence of resistance to antiretroviral drugs poses serious problems. Recent estimates of National AIDS Control Organization (NACO) claim the number of HIV/AIDS to be around 2.5 millions [2] although according to UN statistics the number was much higher. Considering the severe economic constraints, rising HIV/AIDS cases in some states [3] and a population of more than one billion in India, the scenario may worsen in the years to come. Transmission of drug resistant strains in newly infected patients [4] also leads to serious treatment limitations. NACO provides free triple drug regimen containing nevirapine. [5] Thus, such a study in Indian patients assumes special significance. The present study investigates drug resistance mutations to zidovudine (AZT, codon 215), and nevirapine (codon 103) in children with AIDS. Materials and Methods Twenty-five patients of AIDS were recruited from the HIV clinic of the department of paediatrics through an unbiased referral. After an Informed consent and counselling, diagnosis of AIDS was established by a DNA PCR assay . Whole blood DNA was extracted using a kit obtained from Biorad, USA. Amplification of pol region POL pr1 [5′-TTC CCA TTA GTC CTA TTG AAA CTG T-3′] After initial denaturation at 94o C for five minutes, the PCR was carried out for 30 cycles with denaturation at 94°C for one minute, annealing at 58°C for one minute and extension at 72°C for one minute. A typical reaction mixture consisted of 0.5 µgm of template DNA, 1.2 pM of primer1 and primer2 (Sigma Aldrich),600 µmol dNTPs (Bioron), 2.8mM MgCl 2 and 2U of Taq DNA polymerase (Roche, Germany). DNA samples of normal individuals were used as controls. A wild type clone of clade C in pNL4-3 vector was used as a positive control. Codon 215 was amplified by a second PCR of amplified pol gene fragment by a nested cum amplification refractory mutation system (ARMS) PCR using primers specific for wild and mutant types [7] as follows: Pr B- GGA TGG AAA GGA TCA CCA GCA (common upstream primer) A second ARMS PCR was used to detect mutations at codon 103 employing the following set of primers between codons103--219, with 768 base pair pol gene fragment as the starting template: S1 CCAGCAGGGTTAAAAAAGAAA Primers S1+S3 were used for wild and S2+S3 for mutant variant respectively. The PCR conditions were largely the same as for codon 215 except for MgCl 2 concentration of 2.5 mM and annealing temperature of 59°C. Five randomly selected samples were subjected to detailed sequencing using an automatic sequencer employing down stream primer to amplify codon 103 to confirm K103N mutation. Results A total of 25 consecutive children were investigated for mutations at codon 215 and 103. The age of the children ranged from 1.5 years to 12 years with a mean age of 6.14±2.93 years. Out of these, 21 were males and four females. None of the mothers of the babies studied had received prophylactic antiretroviral therapy (ARV) or single dose (SD) nevirapine during labour except that of the new born. Mother to child transmission of HIV was responsible in 23/25 children. Out of the 25 children, six were drug naοve while rest had been on duovir (AZT, 3TC) or/and duovir-N (AZT, 3TC and nevirapine) and subsequently on a free triple drug regimen recommended by NACO (lamivudine stavudine and nevirapine) for at least eight months. Mutations at codon 215 were not observed in any child. On the other hand, the mutations at codon 103 were observed in 56% of the cases [Table - 1]. All children had a wild type of virus in addition to the mutant one. Discussion The prevalence of HIV among pregnant women varies widely from state to state. It is estimated that some 25 million infants are born each year in India with more than 50000 infected with HIV. The WHO dream of meeting the emergency global target of 3/5, i.e., to provide antiretroviral drugs to 3 million people by the end of 2005 has only partially been realized. [8] The government of India launched free ART programme in eight designated centres in April 2004 but less than 10% of the patients have access to ART. In India, interruptions are common due to ignorance, poverty, inability to reach hospital on time etc. Thus, significance of drug resistance particularly of cheaper drugs like nevirapine cannot be over emphasised. Grant et al [ 9] from USA documented that mutation carrying resistance to nucleoside reverse transcriptase inhibitor (NRTI) deceased over time while resistance to non nucleoside reverse transcriptase inhibitors (NNRTI)increased over time; the most significant increase occured at codon 103(K103N) which confers resistance to nevirapine, delavirdine and efavirenz. In India there are no such sequential studies. In a study from Ivory Coast, [10] phenotypic resistance to at least one NRTI was documented in 39.7% of cases, to NNRTI in 8% and to protease inhibitors in 6% of cases. A major factor was thought to be unplanned interruptions. Similarly the HIV-NET 012 study, which used single dose intrapartum nevirapine, then neonatally, resulted in single point mutation in 19% of infants who got infected in spite of nevirapine. [11] In a recent report, Kurle et al documented resistance to NNRTI in 10.5% and 46.15% of infants at 48 hours and two months respectively after a single dose of nevirapine in their study but none showed K103N mutation. [12] The main difference with the present study could be that children in this study were on nevirapine for a much longer period. Some authors recommend abandoning nevirapine to introduce highly active antiretroviral therapy (HAART) to prevent mother-to-child transmission (MTCT). The World Health Organization (WHO) recommended AZT from 28 weeks, plus single dose nevirapine (SDNV) and 3 TC at the onset of labour and a tail of AZT and 3TC for one week for prevention of MTCT and reduction of resistance to NTTRI. [13] In India, it is not possible to adhere to a single regimen because patients often report at different stages of gestation and follow-up is irregular thus each case has to be judged on its own merit. The biggest hurdle is logistics of implementation of the WHO programmes even if funds are made available. The aim should be to use the dosage schedule in such a way that the resistance is minimised yet the transmission rates are drastically lowered to save thousands of children. India has to strike a balance between what is ideal and what is feasible. References
Copyright 2008 - Indian Journal of Medical Microbiology The following images related to this document are available:Photo images[mb08113t1.jpg] |
| |||||||||
