 |
| About Bioline | All Journals | Testimonials | Membership | News |
|
||||||
|
||||||
Indian Journal of Medical Microbiology, Vol. 28, No. 4, October-December, 2010, pp. 290-294 Original Article Study of HIV-1 subtypes in serodiscordant couples attending an integrated counselling and testing centre in Mumbai using heteroduplex mobility analysis and DNA sequencing PR Mehta, S Nema, S Paranjpe, N Ingole, S Wanjare, G Nataraj Department of Microbiology, Seth GSMC & KEM Hospital, Mumbai, India Date of Submission: 22-Oct-2009 Code Number: mb10092 PMID: 20966556 Abstract Aims: To determine the prevalent subtypes of HIV-1 in serodiscordant couples. Keywords: DNA sequencing, HIV-1 subtypes, heteroduplex mobility analysis, serodiscordant couples Introduction HIV discordance is an increasingly encountered phenomenon. Seronegative partners are a particular high-risk group for HIV acquisition; a high proportion of new HIV infections in mature generalized epidemic are likely to occur within discordant couples. [1] What accounts for high rates of HIV-1 discordance and why some individuals remain uninfected despite repeated sexual exposure to HIV-1 is not known. It has been suggested that certain HIV-1 subtypes may be adapted to more efficient heterosexual transmission. [2] In India, although multiple studies have been conducted for detecting HIV subtypes in various high-risk groups, [3],[4] little information is available on HIV-1 subtypes in serodiscordant couples. Hence a study was planned to assess the prevalence of HIV-1 subtypes in serodiscordant couples attending our ICTC, which will help to assess the efficiency of transmission associated with HIV-1 subtypes if any. Materials and Methods A prospective pilot study was carried out in the Integrated Counselling and Testing Centre (ICTC) of our department from September 2007 to August 2008 after getting permission from the institutional ethics committee. Thirty serodiscordant couples among whom one partner was HIV-1 seropositive (for more than 2 years) and the other seronegative with current history of continued unprotected sexual activity within the partnership for at least 1 year and who were not on highly active antiretroviral therapy HAART were enrolled for the study. Written informed consent of both partners including consent to continued couple counselling for 3 months was obtained. Five millilitres of whole blood was collected in an Ethylene Diamine Tetra Acetic acid (EDTA) vacutainer from HIV-1 positive partner only. DNA extraction was done as described by Debomoy K. Lahiri and John I. Nurnberger, Jr. [5] Reagents for DNA extraction were obtained from Himedia Laboratories, Mumbai, India. Five millilitres of whole blood was collected from the negative partner after 3 months of enrolment at the time of follow-up and tested for HIV-1 antibody to prove continued discordance. The DNA extracts that were found satisfactory both qualitatively and quantitatively [5] were stored in eppendorf tubes at −20°C till further analysis. The stored DNA was carried on dry ice in batches of ten to molecular diagnostic laboratory at National AIDS Research Institute, Pune, where the heteroduplex mobility analysis (HMA) and DNA sequencing were carried out. Extracted DNA from all 30 seropositive partners was amplified using env primers for HMA and gag primers for sequencing. Heteroduplex mobility analysis HMA All the primers and plasmids for HMA were supplied by NIH AIDS Research and Reference Reagent Programme, Bethesda, USA. Nested polymerase chain reaction (PCR) for amplifying the env region of HIV-1 was carried out as described by Delwart et al.[6] Primers ED5 5'- ATGGGATCAAAGCCTAAAGCCATGTG- 3' (6556-6581) and ED12 5'- AGTGCTTCCTGCTGCTCCCA AGAACCCAAG-3' (7822-7792) were used to amplify a fragment of approximately 1.25 Kb spanning the V1-V5 coding region of env gene in the first round. Five microlitres of the DNA sample was used. DNA amplification was achieved by programming the thermocycler (Applied Biosystem, Foster City, CA, USA) at 94°C for 2 minutes followed by 3 cycles at 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute. Subsequent 32 cycles were at 94°C for 15 seconds, 55°C for 45 seconds and 72°C for 1 minute; and the final incubation was at 72°C for 5 minutes. Five microlitres of the amplicon from the first round was used in the next round. Primers ES7 5' -TGTAAAACGACGGCCAG TCTGTTAAATGGCAGTCTAGC-3'(7001-7020) and ES8 5' - CAGGAA ACAGCTAGTACCCACTTCTCCAATTGT CCCTCA-3 '(7667-7647) were used to amplify a fragment of 0.7 Kb spanning the V3-V5 coding region of env gene in the second round. PCR conditions were 94°C for 2 minutes followed by 3 cycles at 94°C for 1 minute, 58°C for 1 minute and 72°C for 1 minute. Subsequent 32 cycles were at 94°C for 15 seconds, 58°C for 45 seconds and 72°C for 1 minute; and the final incubation was at 72°C for 5 minutes. The amplified PCR products were run on 1% agarose gel containing ethidium bromide at 65-85 V for 30 minutes to confirm the presence of 700 bp PCR product. HMA was performed as described by Delwart et al.[6] using plasmid PCR product representing subtype A1, B1, C4 and E2. The sample/ reference heteroduplex, which migrated closest to the corresponding homoduplex, determined the subtype designation. Amplified product from the patient's sample served as a control for the homoduplex formation in the absence of any reference strain [Figure - 1] and [Figure - 2]. DNA sequencing gag primers were supplied by Invitrogen Life Science, Carlsbad, California, USA. For DNA sequencing, the gag region of HIV-1 was amplified using nested polymerase chain reaction (PCR). The 600-bp segment of p17 region of gag gene was amplified. Primers for the first round of PCR were GF1 5' TCTCTCGACGCAGGACTCGGCTTGCTG 3' and GC1 5' TAACATTTGCATGGCTGCTTGATGTCC 3'. DNA amplification was achieved by programming the thermocycler (Applied Biosystem, Foster City, CA, USA) at 94°C for 2 minutes followed by 3 cycles at 94°C for 1 minute, 65°C for 1 minute and 72°C for 1 minute. Subsequent 32 cycles were at 94°C for 15 seconds, 65°C for 45 seconds and 72°C for 1 minute; and the final incubation was at 72°C for 5 minutes. Five microlitres of the first round of PCR product was used as template for second round of PCR. Primers for the second round of PCR were GF2 5' CTAGAAGGAGAGAGAGATGGGTGCGAG 3' and GC2 5' CTTGTGGGGTGGCTCCTTCTGATAATG 3'. PCR conditions were 94°C for 2 minutes followed by 3 cycles at 94°C for 1 minute, 68°C for 1 minute and 72°C for 1 minute. Subsequent 32 cycles were at 94°C for 15 seconds, 68°C for 45 seconds and 72°C for 1 minute; and the final incubation was at 72°C for 5 minutes. PCR products were purified by using the method described by Joseph Sambrook et al. for purification of plasmid DNA. [7] Purified PCR products were amplified in the thermocycler (Applied Biosystem, Foster City, CA, USA) in a 96-well microtitre plate. The thermal cycling conditions were 25 cycles at 96°C for 10 seconds, 50°C for 5 seconds and 60°C for 4 minutes. Purification of these new PCR products was achieved by using 80% isopropanol. Later on, 10 microlitres of formamide was added to each well of the plate and was centrifuged and heated at 94°C for 2 minutes, followed by snap chilling on ice. Finally the products were subjected to direct sequencing with BigDye Terminator chemistry on an automated ABI PRISM; 3100 Genetic Analyzer (Applied Biosystem, Foster City, CA, USA). Sequences derived from subgenomic fragments of the gag region were edited by using Bioedit 5.0.6 software. Multiple sequence alignment was done using clustal X version 1.81, and contig was obtained. The subtype was defined by submitting contig to the HIV sequence database ( http://www.hiv.lanl.gov/content/sequence/BASIC_BLAST/basic_blast.html ). Results Of the 30 seropositive partners, 27 (90%) were males. Twenty-eight seropositive partners had unprotected sexual contact with multiple partners, and 2 had received blood transfusion. HIV-1 env gene could be amplified in only 10 samples; and HIV-1 gag gene, in only 25 samples. env, gag or both genes could be amplified in all samples [Table - 1]. HIV-1 subtype C was the predominant subtype, followed by subtype B and subtype A. Subtype of 1 sample was detected as HIV-1 subtype C by env HMA and HIV-1 subtype B by gag sequencing. After the 3-month follow-up, seroconversion was not detected in any of the seronegative partners. Discussion With increasing coverage of the National AIDS Control Programme in India, improved accessibility and sustained efforts to promote partner counselling and testing, the number of partners availing of these facilities is on the rise. With reports of low HIV-1 incidence in married serodiscordant couples, it has become apparent that a large number of couples affected by HIV-1 would be HIV-1-serodiscordant. [8] As seronegative partners within discordant relationship are a particular high-risk group for HIV acquisition, this situation has wide research and clinical implications. [1] In the present study on serodiscordant couples, subtype C was the most predominant, followed by subtype B. In a very short time, India has experienced a rapid, explosive HIV epidemic. Multiple studies of HIV-1 subtypes confirm that subtype C is the most common subtype in India. [3],[4],[9],[10] A similar finding of concordance of subtype prevalence in serodiscordant couples and overall infected population has also been reported by Kiwanuka et al. from Uganda, where HIV-1 subtypes A and D are more common. [11] Sahni et al. found the presence of multiple subtypes, i.e., HIV-1 subtypes A, B, C and E, in India. [10] Although the above studies focused on detection of subtypes in various high-risk groups, to the best of our knowledge the present study on HIV-1 subtypes in HIV-serodiscordant couples is probably the first from India. Various laboratory studies have demonstrated that different HIV subtypes have varying properties related to viral pathogenicity (such as viral fitness and CCR5 vs. CXCR4 tropism), and that these differences may influence transmission efficiency, disease progression and response to antiretroviral therapy. [12] Max Essex reported that HIV-1 subtype C and CRF01-_AE (formerly called subtype E) replicate more efficiently than subtype B in Langerhans' cells. [13] These are the antigen-presenting cells abundantly found in the epithelium of the vagina, cervix and penile foreskin, which are absent in rectal mucosa and are responsible for vaginal transmission, and hence HIV-1 subtype C and CRF01-_AE are believed to be transmitted more efficiently by heterosexual route than any other subtypes. Of the 30 seropositive partners studied, 28 had acquired HIV infection through heterosexual route. HIV-1 subtype C was seen in 22 of these. As subtype B could be detected in 6 cases, it is possible that in India this subtype may have a greater role to play in heterosexual transmission as compared to countries in the regions like northern Africa and Middle East. [14] Both serotyping and genotyping can be used for ascertaining HIV-1 subtypes. But in a country like India, where multiple subtypes predominate, subtype-specific serological techniques have limited role due to chances of cross-reactivity. Therefore, genotypic methods are preferred. In the present study, HIV-1 subtypes were detected by the two commonly recommended genotyping methods, viz., HMA and DNA sequencing. In HMA, subtypes were ascertained by amplifying env region. Despite repeated attempts, env region could be amplified only in 10 out of 30 samples. A similar problem of amplification with env primers has also been reported by Mc Cutchan et al.[15] It is believed that broad heterogeneity within the gp120 region of the HIV-1 env region may be the reason for amplification failure. [15] DNA sequencing using gag region primers was attempted as gag region is said to be more conserved than env region. [16] The gag region could be amplified in 25 of the 30 samples. Therefore, DNA sequencing was done on a total of 25/30 samples. HMA was found to be labour intensive and time consuming as compared to DNA sequencing. Also, the env region could not be amplified in two thirds of the samples. Hence DNA sequencing using gag region primers was found to be better for subtype determination. Similar finding has also been reported by Mandal et al.[9] Discordance in typing was observed with 1 sample, which was detected as subtype C by env HMA and subtype B by gag sequencing. A similar finding has been reported by Payel Bhanja et al. in injecting-drug users in Manipur. [17] This is because some viruses cluster in one subtype when gag sequences are analyzed and in another when env sequences are examined, which suggests that recombination can occur between viral genomes and result in replication-competent viruses. [18] Since the amplicon size was very small, we are unable to comment on the presence of any recombinant forms. Full-length genomic sequencing of such samples should be carried out for final identification of the subtype. Various factors that can affect sexual transmission of HIV are HIV-1 viral load, presence of other sexually transmitted infections, CD4 count, sexual behaviour, Human Leukocyte Antigen (HLA) haplotypes and HIV subtypes. [11],[19] It is possible that these additional parameters may determine the efficiency of heterosexual transmission, though it has been suggested that HIV-1 subtypes should be considered as a new parameter when constructing mathematical models of transmission. To conclude, HIV-1 subtype C was found to be the commonest subtype in our study group. env region of the HIV-1 was difficult to amplify as compared to the gag region. DNA sequence analysis was found to be better than HMA for determining the nature of the HIV-1 subtype. References
Copyright 2010 - Indian Journal of Medical Microbiology The following images related to this document are available:Photo images[mb10092t1.jpg] [mb10092f2.jpg] [mb10092f1.jpg] |
| |||||||||
![[Figure - 1]](/showimage?mb/photo/mb10092f1.jpg){kind=link}
![[Figure - 2]](/showimage?mb/photo/mb10092f2.jpg){kind=link}
![[Table - 1]](/showimage?mb/photo/mb10092t1.jpg){kind=link}