Indian Journal of Medical Microbiology Medknow Publications on behalf of Indian Association of Medical Microbiology ISSN: 0255-0857 EISSN: 1998-3646 Vol. 28, Num. 4, 2010, pp. 299-302

Indian Journal of Medical Microbiology, Vol. 28, No. 4, October-December, 2010, pp. 299-302

Original Article

Molecular characterization of Chikungunya virus during an outbreak in South India

P Srikanth¹, G Sarangan¹, K Mallilankaraman², SA Nayar¹, R Barani¹, T Mattew³, GF Selvaraj⁴, KA Sheriff⁴, G Palani⁴, K Muthumani²

¹ Department of Microbiology, Sri Ramachandra Medical College and Research Institute, Sri Ramachandra University, Chennai, Tamil Nadu, India
² Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, Philadelphia, USA
³ Department of Community Medicine, T.D. Medical College, Alappuzha, Kerala, India
⁴ Department of Virology, King Institute of Preventive Medicine, Chennai, Tamil Nadu, India
Correspondence Address: P Srikanth, Department of Microbiology, Sri Ramachandra Medical College and Research Institute, Sri Ramachandra University, Chennai, Tamil Nadu, India, srikanth_padma@rediffmail.com

Date of Submission: 21-May-2010
Date of Acceptance: 05-Aug-2010

Code Number: mb10094

PMID: 20966558
DOI: 10.4103/0255-0857.71812

Abstract

Introduction: Re-emergence of Chikungunya is a major public health problem in the southern states of India.
Objectives: This study was undertaken to investigate an outbreak of Chikungunya, in June-August 2008 using PCR and determine the prevalent genotypes of Chikungunya virus (CHIKV) associated with the outbreak.
Materials and Methods: Samples of blood were collected (in heparinized vacutainer tubes) from suspected patients of CHIKV infection from both Government Taluk Hospital in Kerala and a tertiary care hospital in Chennai, Tamil Nadu. A one-step RT-PCR was carried out on a block thermo-cycler targeting the E2 gene that codes for the viral envelope protein. The amplicons were verified for 305 bp size by standard agarose gel electrophoresis. The PCR products were purified, sequenced, and compared with other CHIKV strains reported from different geographical regions. A phylogenetic tree was constructed using MEGA 4.
Results: Altogether 118 samples were collected from patients who presented with sudden onset of fever and/or joint pain, myalgia, and headache. CHIKV infection was confirmed by RT-PCR in 14 patients and all these cases were from Kerala. The positivity correlated with the early stage of the disease as all these patients had fever of less than seven days duration. The study isolates have been allotted the GenBank accession nos. GQ272368-GQ272381. Phylogenetic analysis of recent CHIKV isolates by partial sequencing of E2 region shows that isolates are closely related to strains from neighboring states and the African type.
Conclusion: RT-PCR is a useful technique for the early detection of CHIKV infection during outbreaks. Molecular characterization of the strains indicates that majority of the strains have originated from the Central/East African strains of CHIKV.

Keywords: Chikungunya virus, envelope E2 gene, epidemic, India, phylogenetic analysis

Introduction

Chikungunya virus (CHIKV), an alpha virus belonging to the Togaviridae family, made its first known appearance in 1952−53, when it was first isolated from both humans and mosquitoes in Tanzania (formerly Tanganyika) during an epidemic of fever considered clinically indistinguishable from Dengue. ^[1],[2] Since then, CHIKV has caused several epidemics in Africa and Southeast Asia and is a re-emerging agent of public health importance. ^[3]

CHIKV is transmitted by both Aedes aegypti and Aedes albopictus mosquitoes. The virus is enveloped and the genome consists of a single-stranded, positive-sense RNA (Ribonucleic acid) molecule of approximately 12 000 nucleotides. The complete nucleotide sequence of the virus has been described with evidence for an internal polyadenylation site. ^[4] An A226V shift in E1 gene, substitution of alanine at position 226 with valine, has led to a successful evolutionary adaptation in the mosquito vector Aedes albopictus. This has allowed Aedes albopictus to supplant Aedes aegypti as the primary vector. ^[5]

The first Indian outbreak of CHIKV was reported in 1963 in Kolkata, ^[6] followed a decade later by a small outbreak in 1973 in Maharashtra, ^[7] Re-emergence of Chikungunya in India after 32 years resulted in 1.4−6.5 million estimated cases across 13 different states. ^[8] However, the impact of outbreaks was severe in southern states of India viz Andhra Pradesh, Tamil Nadu, Karnataka, and Kerala. ^[9],[10] Chikungunya virus illness is associated with fever, severe arthralgia, rash, headache, myalgia and retro-orbital pain, is not typically fatal, but is associated with significant morbidity. A phylogenetic analysis of CHIKV isolates based on partial sequences of NS4 and E1 genes from Andhra Pradesh, Karnataka, and Maharashtra indicated that they belonged to the African genotype, unlike the earlier isolates that were Asian genotype. ^[11] There is a need to continuously monitor Chikungunya outbreaks in order to plan control measures.

Objectives

This study was undertaken to investigate an outbreak of Chikungunya in June-August 2008 and determine the prevalent genotypes of CHIKV associated with the outbreak.

Materials and Methods

Samples of blood were collected from suspected patients of CHIKV infection from Government Taluk (District) Hospital in Kerala and a tertiary care hospital in Chennai, Tamil Nadu in 2008. Blood was collected in heparinized vacutainer tubes (Becton and Dickinson, USA) and transported to the laboratory and processed.

Viral RNA was extracted from plasma using the QIAamp Viral RNA Mini kit (Qiagen, USA) according to the manufacturer's instructions. A one-step RT-PCR was carried out using Qiagen one-step RT-PCR (Qiagen, USA) kit on a block thermo-cycler (PTC-200, MJ Research, USA). The primers used in the study (CHIK1-forward TATCCTGACCACCCAACGCTCC; CHIK 2-reverse ACATGCACATCCCACCTGCC) amplified 305 bp within the gene that codes for the viral envelope protein E2. ^[12] The E2 gene was selected as the target region for the RT-PCR because this gene shows a high-degree of divergence among the alpha viruses and harbors virus-specific nucleotide stretches suitable for primer design. ^[12] The amplicons were verified for the size (305 bp) by standard agarose gel electrophoresis.

The PCR products were purified using the PCR purification kit (Bioneer, Korea) and sequenced in an automated sequencer (ABI Prism 3100 Genetic Analyzer, Applied Biosystems, USA) using the big dye terminator cycle sequencing ready reaction kit (Applied Biosystems, CA, USA). The partial nucleotide sequence of the E2 gene obtained from the isolates of the present study were compared with other CHIKV strains reported from different geographic regions including India and Africa [Table - 1]. Nucleotide homology percentages were calculated using the sequence similarity search tool BLAST ,(Basic Local Alignment Search Tool) and the cDNA sequences were aligned using Clustal X 1.83 software. ^[13] Phylogenetic tree was constructed using MEGA 4 ^[14] Kimura 2-parameter, which includes E2 sequences of all the three genotypes from the GenBank and isolates from the 2008 outbreak in Kerala, India. The interior-branch test was carried out using 1000 bootstrap replications to examine the statistical significance of the branching pattern.

Results

In all, 118 samples were collected from patients who presented with sudden onset of fever in association with a wide array of symptoms including fever/joint pain, myalgia and headache. Majority (42%) of patients presented with fever, of which 11% had fever with chills. Severe joint pain (26%), headache (12%), maculopapular rash (4%), and hemorrhagic manifestations (2%) were the other symptoms documented. The cases were in the age group varying from 6 to 80 years; majority (61.8%, n = 73) of suspected CHIKV patients belonged to the age group of 20−50 years; significantly more positive cases occurred in persons aged between 20 and 50 years (P < 0.001), 18% of cases belonged to the age group less than 20 years.

CHIKV infection was confirmed by RT-PCR in 14 patients and all these cases were from Kerala. The patients whose samples tested positive for CHIKV corresponding to 305 bp are shown in [Figure - 1], along with three samples that tested negative (positive control source, King Institute, Guindy, Chennai). The positivity correlated with the early stage of the disease as all these patients had fever for duration of less than seven days. RT-PCR, thus, is a useful technique for the early detection of CHIKV infection during outbreaks.

Nucleotide sequence of the partial E2 gene (305 nucleotides) of 14 CHIKV-positive isolates were analyzed and compared with other globally diverse CHIKV isolates [Table - 1]. The study CHIKV isolates were submitted to GenBank and have been allotted the GenBank accession nos. GQ272368-GQ272381. The phylogenetic tree constructed using the study isolates and O'nyong nyong strain as an out group and the three genotypes from the GenBank is shown in [Figure - 2]. The phylogenetic analysis of the 14 CHIKV partial nucleotide sequences and their deduced amino acid sequences from the patient samples showed 80−100% sequence homology. Among the 14 isolates, 13 had sequence homology in the range of 97-100%, only one sequence (IND08KL10) was slightly dissimilar showing an identity of only 80% with the other sequences from the outbreak and GenBank database sequences.

The phylogram showed the distribution of the positive strains along with the East Central South African (ECSA), Asian and West African strains. The positive strains clustered with the ECSA strains, which were isolated from other parts of the country like Maharashtra (2000) GenBank accession Number EF027139, Tamil Nadu (2006) GenBank accession Number EF027138, Rajasthan (2006) GenBank accession Number EU564335, and Pondicherry (2007) GenBank accession Number EF501985 [Figure - 2], and did not cluster with the strains that caused outbreaks in India during 1963, 1973, and 2003 (Asian genotype).

Discussion

Chikungunya fever after emerging as an outbreak after 32 years has established itself in this part of the country. A wide array of symptoms was observed among the study subjects, which is similar to previous reports. ^[10] Cases with suspected CHIKV belonged to the age group 6−80 years with majority of symptomatic cases occurring in the age group 20−50 years. Since a significant number of PCR-positive cases occurred in the age group 20−50 years, a group that is actively involved in work during the daytime, it suggests a corollary with the day feeding habits of the Aedes mosquito.

The RT-PCR technique was useful in detecting the viral infection in the acute phase and also indicates the usefulness of molecular techniques in an outbreak scenario. Recently another report highlighted the importance of PCR in early detection of CHIKV CNS infections. ^[15] PCR is also useful in tracing the evolution of the virus by phylogenetic analysis. Among the 118 samples tested by PCR for CHIKV, 14 samples tested positive, the reason for negativity of the remaining samples is unclear. PCR is a more sensitive method for detection of the virus in the first week of disease onset. ^[16] Further studies on CHIKV that correlate molecular diagnostics with disease onset and progression may provide a better understanding.

A comparison of phylogenetic relationship of the sequences from this current outbreak with other sequences available in the GenBank indicates that the outbreak in Kerala has originated from the Central/East African strains of CHIKV, except for one strain (IND08KL10). Outbreaks of highly similar strains that are persistent in Kerala have also been reported in Tamil Nadu. ^[17] The phylogram in the current study clearly shows the presence of multiple genotypes with epidemic potential. Since the strains reported during the recent outbreak are from a single geographic region, a rural region, and cluster around the African genotype, this suggests endemicity of the African genotype. Such endemic foci may lead to periodic re-emergence of CHIKV as has occurred in Malaysia, ^[18] or lead to a spread to urban cities. ^[19] The persistence of Chikungunya epidemic for such a long duration; along with the mutation in the virus during the outbreak in Kerala in 2007, ^[20] poses a serious public health challenge.

The re-emergence and persistence of CHIKV suggests the need for continuous monitoring and identification of the newly evolving variants and their genetic divergence with a view to plan for appropriate strategies for vaccine development. Further studies on, the vector prevalence, the environmental conditions that favor the persistence of CHIKV, serosurveys in humans, and mosquitoes in the affected areas are required to better understand the dynamics of Chikungunya in this region and prevent further spread of the virus to other parts of the country.

Acknowledgment

We are grateful to Dr. Narayana Naik, Superintendent, Dr. Janardhana Naik, Consultant Physician & Geriatrician, Mr. Vincent Sebastian, Lab Technician (Lab In-charge), Govt. Taluk Head Quarters Hospital, Kasargod, Kerala, India, for support to carry out this study. We thank Mr. D. Raja, Scientist, Dept. of Virology, King Institute of Preventive Medicine, Guindy, Chennai, India, for assistance in sequence analysis.

References

Copyright 2010 - Indian Journal of Medical Microbiology

The following images related to this document are available:

Photo images