Indian Journal of Medical Microbiology Medknow Publications on behalf of Indian Association of Medical Microbiology ISSN: 0255-0857 EISSN: 1998-3646 Vol. 29, Num. 1, 2011, pp. 51-55

Indian Journal of Medical Microbiology, Vol. 29, No. 1, January-March, 2011, pp. 51-55

Original Article

Evaluation of a commercial Dengue NS1 enzyme-linked immunosorbent assay for early diagnosis of dengue infection

A Shrivastava¹, PK Dash¹, NK Tripathi¹, AK Sahni², N Gopalan¹, PV Lakshmana Rao¹

¹ Defence Research and Development Establishment, Jhansi Road, Gwalior-474 002, India
² Army Hospital (Research & Referral) , New Delhi, India

Correspondence Address: A Shrivastava, Defence Research and Development Establishment, Jhansi Road, Gwalior-474 002, India, ambujshrivastava@hotmail.com

Date of Submission: 27-Nov-2010
Date of Acceptance: 18-Jan-2011

Code Number: mb11012

PMID: 21304196

DOI: 10.4103/0255-0857.76525

Abstract

Keywords: Antigen capture, dengue virus, ELISA, lateral flowthrough test, non-structural 1 protein

Introduction

Dengue fever is an important mosquito-borne viral disease of humans. This has been a recurrent phenomenon throughout the tropics in the past decade. Annually, there are an estimated 100 million dengue virus infections worldwide.^[1] Increasingly, cases of the more severe and potentially lethal dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS) are reported with children bearing much of the disease burden. ^[2] The mortality rate of DHF in most countries is 5%, primarily among children and young adults. ^[3] In several Asian countries, this virus is the leading cause of hospitalization and death in children.^[3] Hence, there is a need for diagnostics, prophylactics and therapeutics to manage DHF. Dengue virus is an enveloped positive-sense RNA virus. The genomic RNA is approximately 11 kb in length and is composed of three structural protein genes that encode for nucleocapsid or core protein(C), a membrane-associated protein (M), an envelope protein (E), and seven non-structural (NS) protein genes including NS1 protein. ^[4] Among the non-structural proteins, NS1 is a highly conserved glycoprotein which appears essential for virus replication, although no precise function has yet been assigned to it. During acute dengue virus infection, NS1 is found associated with intracellular organelles or is transported through the cellular secretory pathway to the cell surface. ^[5],[6],[7] The hexameric form of dengue virus NS1 protein was also found circulating in the sera of patients during the acute phase of the illness. ^[8] Early diagnosis plays a crucial role in forecasting an early warning of an epidemic and in undertaking effective vector control measures. The precise diagnosis is achieved either by isolating the virus or by identifying viral RNA through RT-PCR ^[6] or by serodiagnosis by detecting dengue-specific IgM and IgG antibodies. ^[9] Both virus isolation and RT-PCR are time-consuming and costly laboratory methods. Thus, in a majority of cases the only feasible diagnosis is based on the detection of dengue antigens or antibodies. An enzyme-linked immunosorbent assay specific to dengue virus non-structural 1 (NS1) protein has been developed for the detection of dengue NS1 antigen during the acute phase of disease in patients experiencing primary and secondary infections. ^{[8],[9],[10],[11]} It possesses not only group-specific but also type-specific determinants and has been recognized as an important antigen in dengue infection. ^[7],[9] A high circulating level of NS1 was demonstrated in the acute phase of dengue by antigen capture ELISAs. ^[10],[11] Antigen detection of non-structural dengue antigens may be of benefit for an early-stage rapid diagnosis of infection due to its long half life in the blood. ^[12] In this report, an evaluation of a commercially available dengue NS1 antigen-capture ELISA vis-à-vis SD bioline Dengue NS1 antigen test was carried out to demonstrate its potential application for early laboratory confirmation of dengue infection compared with other laboratory methods of dengue diagnosis, viz. virus isolation and molecular detection of dengue genomic RNA by reverse transcriptase-polymerase chain reaction (RT-PCR).

Materials and Methods

The study

Blood specimens were collected from patients clinically suspected of dengue during September to November 2008 from the Army Hospital (Research & Referral), New Delhi and stored at this Virology laboratory, which is one of the National Apex Referral Labs designated by the Ministry of Health and Family Welfare, Government of India for laboratory confirmation of acute dengue. Most of the patients belonged to the age group of 15-30 years and male to female ratio was 1.7. In the laboratory, dengue virus isolation was carried out employing C6/36 cell-line obtained from the National Centre for Cell Sciences, Pune. Simultaneously, molecular detection for dengue virus genome by RT-PCR using our published oligonucleotide primers was carried out on the acute phase serum samples. Remaining excess serum samples were stored in a minus 80ºC freezer for later use.

Panbio rapid IC test for detection of IgM and IgG antibodies

All the samples were tested for detection of anti-dengue IgM and IgG antibodies employing Panbio rapid IC test as per manufacturer′s protocol.

Panbio dengue early ELISA

One hundred microlitres of diluted (1:10 in serum diluent) patient serum, positive control, negative control, or calibrator was added to microwells precoated with a polyclonal capture anti-NS1 antibody and then incubated for 1 h at 37ºC. The plates were washed six times and incubated for an additional 1 h at 37ºC following the addition of HRP-conjugated anti-NS1 MAb. After an additional six washes, antibody complexes were detected by adding TMB and incubating samples for 10 min at room temperature. The reaction was stopped by adding stop solution (1 M H ₃ PO ₄ ), and the plates were read. The cut-off value was determined by multiplying the average OD of the calibrator (tested in triplicate) by the lot-specific calibration factor (provided in the kit insert). An index value was calculated by dividing the average OD of each sample by the cut-off value. Index values of <0.9, 0.9 to 1.1, and >1.1 were considered negative, equivocal, and positive, respectively.

SD Bioline dengue NS1 Antigen test

The Dengue NS1 antigen rapid test is an in-vitro immunochromatographic, one-step assay designed for the qualitative determination of dengue virus NS1 antigen in human serum, plasma for the diagnosis of early acute dengue infection. About one hundred microlitres of patient serum was added into the sample well marked "S" and the test result was interpreted in 15~20 min. The presence of only one colour line within the result window indicated negative result and the presence of two colour lines ("T" band and "C" line) indicated a positive result. When no control line (C) was found the test was concluded as invalid.

RNA isolation

Viral RNA was isolated from 140 μl of dengue-suspected serum samples employing QIAamp Viral RNA mini kit (QIAGEN, Germany) following manufacturer′s protocol. Finally, RNA was eluted in 50 μl of DEPC-treated water and used as template for RT-PCR.

Reverse transcription-Polymerase chain reaction (RT-PCR)

RT-PCR was carried out using a set of primers for dengue virus complex consensus primers (D1: 5′ TCAATATGCTAAAACGCGCGAGAAACCG 3′ and D2: 5′ TTGCACCAACAGTCAATGTCTTCAGGTTC 3′). Complementary DNA (cDNA) was synthesized in 20 μl reaction volume with RT mix comprising 5X-RT buffer, dNTPs, RNasin^® ribonuclease inhibitor and Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV-RT) (Promega, USA) for 1 h at 37ºC with dengue virus group-specific consensus downstream primer (D2) (GENSET, Singapore). The amplification of cDNA was carried out in 50 μl reaction volume with PCR mix containing 10X PCR buffer, 25 mM MgCl _2, dNTPs, Taq-DNA polymerase (Promega, USA),using dengue consensus upstream primer (D1), (GENSET, Singapore) in a thermal cycler (Perkin - Elmer-480). The thermal profile of the PCR reaction was: initial denaturation at 95ºC for 2 min followed by 30 cycles of denaturation at 94ºC for 30 sec, annealing at 54ºC for 2 min, extension at 72ºC for 2 min and final extension at 72ºC for 10 min. The PCR products were electrophoresed on 1.2% agarose gel.

Virus isolation

Dengue virus isolations were attempted in RT-PCR positive samples by tissue culture using 0.2 ml of patients′ serum inoculated into each of the 25 cm ² tissue culture flasks (Nunc, Roskilde, Denmark) containing Aedes albopictus mosquito (C6/36) cell monolayers. After 90 min of adsorption of the inoculum onto the cells at 28ºC, cell cultures were incubated for seven days at 28ºC. Cells were harvested for identification of virus using dengue complex-specific primers in conventional reverse transcriptase polymerase chain reaction as described above.

Results

All 91 serum samples were tested by NS1 Capture ELISA (Panbio, Australia) as well as SD lateral flow NS1 test kits (Standard Diagnostics, South Korea) for the detection of NS1 antigen in dengue-infected serum samples. Detection of anti-dengue IgM and IgG antibodies was carried out by using Panbio rapid IC test. All the samples were also tested by RT-PCR, and those found positive were attempted for virus isolation. The results of Panbio dengue early ELISA were compared with those of SD lateral flow test. The overall performance of the Panbio Early ELISA NS1 antigen capture ELISA with respect to virus isolation, molecular detection and SD NS1 LFT in each category, is shown in [Table - 1]. Out of 91 serum samples 24 (26%) were positive by the Panbio NS1 Early ELISA test kit and 15 (16.5%) by SD lateral flow test. From antibody profiles of all samples, six IgM, seven IgG and five both (IgM and IgG) positive samples were found. One IgM-positive sample was found positive for NS1 antigen by both NS1 antigen detection assays. None of the IgG-positive samples was found positive for NS1 antigen. However, one both (IgM and IgG) positive sample was NS1 antigen-positive by only Panbio dengue early ELISA. Molecular detection of dengue RNA by RT-PCR gave an overall positive detection rate of 12% (11/91). Further, virus isolation from RT-PCR-positive samples resulted in three isolates which was again confirmed by RT-PCR. In comparison, virus isolation gave an overall positive isolation rate of 27.27% (03/11) with the RT-PCR-positive samples. All the 15 samples positive by SD test were also positive by Panbio test. All the three isolates were positive by Panbio test but only two isolates were positive by SD Test. Out of 11 RT-PCR-positive samples, eight samples were positive by Panbio test and seven samples by SD test. All the seven samples positive by SD test were also positive by Panbio test. The distribution of OD ₄₅₀ range with respect to all the samples is presented in [Table - 2]. OD ₄₅₀ values of ≥0.5 were considered positive at a serum dilution of 1:10. The results of dengue early ELISA versus SD NS1 LFT are given in [Table - 3]. The sensitivity, specificity, agreement, positive predictive value and negative predictive value are presented in [Table - 4].

Discussion

Dengue infection presents with nonspecific fever that mimics other viral illnesses. The availability of commercial ELISA assays to detect the DENV NS1 protein in acute plasma provides an additional dengue diagnostic tool to the existing approaches of PCR, antibody capture ELISA and, less frequently, virus isolation. ^{[7],[8],[9],[13],[14],[15],[16],[17],[18]} The assessment of NS1 antigen detection assays as diagnostic tools across a wide range of patient populations and viral serotypes is an important part of the process of identifying infections where these assays may fit into existing dengue diagnostic algorithms. In order to provide timely information for the management of the patients, and early public health control of dengue outbreaks, it is important to establish the diagnosis of acute dengue virus infection during the first few days after manifestation of clinical symptoms.

At present, the three basic methods used by most laboratories for the diagnosis of dengue virus infection are viral isolation; detection of viral genomic sequence by a nucleic acid amplification technology assay (RT-PCR), and detection of dengue virus-specific IgM antibodies by the IgM-capture enzyme-linked immunosorbent assay (MAC-ELISA) and/or the rapid dengue immunochromatographic test (ICT). Though virus isolation and characterisation are considered as the gold standard of laboratory diagnosis for acute dengue virus infection, it is expensive and takes at least 6-10 days for the virus to replicate in cell culture or laboratory mosquitoes. Detection of viral genomic sequence by RT-PCR is also an expensive method and is not widely available in most hospital diagnostic laboratories. The third method, assay of anti-dengue-specific IgM, depends on the time taken for an infected person′s immunological response to produce IgM antibodies against dengue virus antigens. Thus, both ICT (often considered as the rapid test for diagnosis of dengue infection) and MAC-ELISA do not provide early diagnosis of acute dengue infection, as in most cases, the first detectable IgM only appears on days 4-5 of the illness. Moreover, a single serological detection of IgM is merely indicative of a recent dengue virus infection, and should not be interpreted as a confirmatory diagnosis of acute infection without a paired second serum sample. This evaluation clearly shows that the Panbio dengue early ELISA kit gives an overall higher sensitivity rate than SD bioline Dengue NS1 antigen test for laboratory diagnosis of acute dengue infection. The dengue early ELISA has the added advantage of giving good detection rates up to seven days of the illness. ^[8] The reason behind the less number of virus isolates could be the inactivation of the virus during transit due to improper maintenance of strict cold chain.

NS1 protein was found to be highly conserved for all dengue serotypes, circulating in high levels during the first few days of illness, and correlates with the development of DHF. ^[11],[16] Earlier studies found the presence of NS1 antigen in 82-83% of patients with dengue infection from day 1 up to day 9 to 18 after the onset of fever. ^[10],[19] The dengue NS1 antigen was not found in patients with Japanese encephalitis virus or yellow fever virus infections ^[18] thereby implying that there is no cross-reaction of dengue NS1 protein with those of other related flaviviruses. Thus detection of NS1 has been a promising test to diagnose dengue in its early febrile stage. ^{[10],[19],[20],[21],[22],[23],[24]}

Plasma viremia levels would be associated with the detection of plasma NS1, since NS1, like virions, is a product of infected cells. Accordingly, viremia levels were significantly higher in patients who were NS1-positive at the time of study enrolment versus those who were NS1-negative, in both the Panbio NS1 Early ELISA assay and SD NS1-LFT (data not shown). Firstly, not every acute dengue case has measurable NS1 antigenaemia and the present study suggests that this is a reflection of the viraemia, with NS1-negative patients having a significantly lower mean viraemia than NS1-positive patients with the same duration of illness history. Secondly, sensitivity declines with increasing time since the onset of symptoms and this is likely a reflection of decreasing viral burden. ^{[9],[14],[17]}

A possible explanation for reduced NS1 sensitivity in the presence of a measurable anti-DENV antibody response is that the plasma NS1 is sequestered in immune complexes and the target epitopes are not accessible to either the plate-bound or probe mAb in the NS1 ELISA. Indeed, efforts to dissociate immune complexes can enhance the sensitivity of the Panbio early ELISA assay. ^[13] They may already have an established anamnestic humoral immune response characteristic of a secondary infection and are therefore more likely to be NS1-negative. It is therefore imperative that clinicians and laboratorians should understand the limitations of existing NS1 antigen tests; that a NS1-negative result does not rule out the diagnosis of dengue. Further work is needed to determine the sensitivity of the test with a bigger sample size of patients. In conclusion, NS1 antigen test is a potentially useful test during early febrile stage. An outstanding point of the test is its high specificity during early infection. However, no single diagnostic assay in isolation is adequately sensitive and specific enough to diagnose all acute cases of dengue and therefore a battery of tests has to be performed to arrive at a confirmatory diagnosis of dengue infection.

Acknowledgment

The authors are thankful to Dr. R. Vijayaraghavan, Director, DRDE, Gwalior for his keen interest, support, providing necessary facilities for this study.

References

Copyright 2011 - Indian Journal of Medical Microbiology