 |
| About Bioline | All Journals | Testimonials | Membership | News |
|
||||||
|
||||||
Indian Journal of Medical Microbiology, Vol. 29, No. 3, July-September, 2011, pp. 262-268 Original Article Identification of plasmid-mediated quinolone resistance genes qnrA1, qnrB1 and aac(6')-1b-cr in a multiple drug-resistant isolate of Klebsiella pneumoniae from Chennai H Magesh1, C Kamatchi1, R Vaidyanathan1, G Sumathi2 1 Department of Biotechnology, Dr. M.G.R. Educational and Research Institute, Maduravoyal, Chennai - 600 095, India Date of Submission: 09-May-2011 Code Number: mb11064 PMID: 21860107 DOI: 10.4103/0255-0857.83910 Abstract Purpose: Resistance to fluoroquinolones, a commonly prescribed antimicrobial for Gram-negative and Gram-positive microorganisms, is of importance in therapy. The purpose of this study was to screen for the presence of Plasmid-Mediated Quinolone Resistance (PMQR) determinants in clinical isolates of Klebsiella pneumoniae. Materials and Methods: Extended-Spectrum Beta-Lactamase (ESBL) isolates of K. pneumoniae collected during October 2009 were screened by the antimicrobial susceptibility test. The plasmids from these isolates were analysed by specific Polymerase chain Reaction (PCR) for qnrA, qnrB and aac(6')-1b. The amplified products were sequenced to confirm the allele. Results: Our analysis showed that 61% out of the 23 ESBL K. pneumoniae isolates were resistant to ciprofloxacin and 56% to levofloxacin. The PMQR was demonstrated by transforming the plasmids from two isolates P12 and P13 into E. coli JM109. The PMQR gene qnrA was found in 16 isolates and qnrB in 11 isolates. The plasmid pKNMGR13 which conferred an minimum inhibitory concentration (MIC) of more than 240 ΅g/ml in sensitive E. coli was found to harbour the qnrA1 and qnrB1 allele. Furthermore, the gene aac(6')-1b-cr encoding a variant aminoglycoside 6'-N Acetyl transferase which confers resistance to fluoroquinolones was found in the same plasmid. Conclusions: Our report shows the prevalence of PMQR mediated by qnrA and qnrB in multidrug-resistant K. pneumoniae isolates from Chennai. A multidrug-resistant plasmid conferring high resistance to ciprofloxacin was found to harbour another PMQR gene, aac(6')-1b-cr mutant gene. This is the first report screening for PMQR in K. pneumoniae isolates from India.Keywords: Aac(6′)-1b-cr, Klebsiella pneumoniae, plasmid-mediated quinolone resistance, qnrA, qnrB Introduction Quinolones constitute an important group of antimicrobials active against Gram-negative and Gram-positive bacteria. [1] Fluoroquinolones are the third largest selling drug class with sales of US$ 7.1 billion, accounting for 17% of the world antibiotic market in 2009. [2] Since the introduction of fluoroquinolones for therapy in 1962, resistance of the Enterobacteriaceae to these agents has become common, widespread and generally non-clonal. [3] Quinolone resistance can be due to mutations in the chromosomal genes for the DNA gyrase and topoisomerase IV, the targets of quinolone action; and by changes in expression of efflux pumps and porins that control the accumulation of these agents inside the bacterial cell. [4] Plasmid-mediated quinolone resistance (PMQR) was first reported in 1988 in a fluoroquinolone-resistant strain of Klebsiella pneumoniae in Alabama, USA. [5] This gene encoding quinolone resistance, named qnrA1, belongs to a pentapeptide repeat family. Two other transferable quinolone resistance determinants have also been described, aac(6′)-Ib-cr which encodes a variant aminoglycoside acetyltransferase with two amino acid alterations allowing it to inactivate ciprofloxacin [6] and qepA genes which encode efflux pumps that extrude quinolones. [7] The qnr genes show a high level of diversity. Five main types of the qnr genes, qnrA,[5] qnrB,[8] qnrC,[9] qnrS[10] and qnrD,[11] have been identified. The qnrB gene was identified first in an isolate of K. pneumoniae from South India, and subsequently has been found in isolates in the USA, Korea, Kuwait, France and Taiwan. [3],[8] The qnrA genes were also reported in K. pneumoniae from South Indian isolates in the same paper. [8] Since the report of Jacoby et al., there has not been any screening for the prevalence of the qnr genes in K. pneumoniae isolates in India. In a study from our laboratory, we analysed 23 isolates of K. pneumoniae collected in October 2009 and found them to be Extended-Spectrum Beta-Lactamase (ESBL) isolates with plasmids containing different combinations of blaSHV , blaOXA-1 and blaCTX-M genes. Since ESBL isolates are frequently resistant to quinolones, and the plasmids containing ESBL genes also have the genes conferring quinolone resistance, we undertook this study to screen for qnr genes in these 23 ESBL isolates of K. pneumoniae collected in October 2009. This is the first report from India demonstrating plasmid-mediated quinolone resistance (PMQR) mediated by qnr genes and the aac(6′)-1b-cr allele in K. pneumoniae. Materials and Methods Bacterial isolates Twenty-three clinical isolates of K. pneumoniae collected from tertiary care hospitals during Oct 2009 were subjected to routine culture and antibiotic susceptibility testing. Antimicrobial susceptibility testing Antibiotic susceptibility testing was performed according to standard methods on Mueller Hilton agar (Himedia Laboratories Pvt. Ltd., Mumbai, India). The antibiotics Norfloxacin (10 μg disk-1, Himedia Laboratories Pvt. Ltd., Mumbai, India), Levofloxacin (5 μg disk- 1, Himedia Laboratories Pvt. Ltd., Mumbai, India) and Ciprofloxacin (5 μg disk-1 , Himedia Laboratories Pvt. Ltd., Mumbai, India) were used for antibiotic susceptibility screening. The results were interpreted as per the CLSI guidelines. [12] Minimum inhibitory concentration of Ciprofloxacin was determined by the HiComb TM E-Strip from Himedia Laboratories Pvt. Ltd., Mumbai, India, following the manufacturer′s instructions. PCR amplification and sequence analysis Amplification of the qnrA, qnrB and qnrS genes was performed for all the K. pneumoniae isolates using the primer sets described in a previous report. [13] PCR experiments were carried out according to standard conditions (annealing temperature at 55°C [for qnrA], 60°C [for qnrB and qnrS] and extension 1 min at 72°C, 35 cycles) using primers synthesised by Eurofins Genomics India Pvt. Ltd, Bangalore, India. Taq DNA polymerase (Biotools, B and M Labs, Madrid, Spain) and dNTP (Cinna Gen Inc. Tehran, Iran) were used as per standard protocols. For detecting the aac(6′)-1b, primers were chosen to amplify all known aac(6′)-Ib variants. [14] The primers used were 5′-TTGCGATGCTCTATGAGTGGCTA-3′ and 5′-CTCGAATGCCTGGCGTGTTT-3′ which produce a 482-bp product. PCR conditions were 94°C for 45 s, 55°C for 45 s and 72°C for 45 s for 34 cycles. The aac(6′)-Ib variants allele was identified by direct sequencing of the PCR product with primer 5′ CGTCACTCCATACATTGCAA 3′. DNA was prepared for the PCR reaction by suspending a single colony of the clinical isolate in 500 μl of sterile Millipore water in a 1.5 eppendorf tube, followed by boiling at 100°C for 5 minutes and centrifuged at 5,000 rpm for 10 minutes. [15] Two μl of supernatant was used as DNA source for the PCR reaction. PCR experiments were carried out according to conditions given. The PCR products were analysed on a 1.5% agarose gel (Himedia Laboratories Pvt. Ltd., Mumbai, India) and the DNA bands were visualised by staining with Ethidium Bromide (Himedia Laboratories Pvt. Ltd., Mumbai, India). The 100 bp DNA Marker from Medox Biotech India Pvt. Ltd., Chennai, India, was used for sizing the PCR bands. The PCR-amplified products were sequenced by SciGenom Labs Pvt. Ltd., Cochin, Kerala, India. The sequence from the chromatogram were analysed by BLAST and compared with known alleles to identify the correct allele. Plasmid isolation and transformation Plasmids from the clinical isolates of K. pneumoniae were isolated using HiPurATM Plasmid DNA Mini and Midi prep purification Spin Kit (HiMedia Laboratories Pvt. Ltd., Mumbai, India). For transformation experiments, plasmid DNA was isolated from two fluoroquinolone isolates of K. pneumoniae (Isolate P12 and P13) and transformed into a recipient strain (E. coli JM109). E. coli JM109 is resistant to Nalidixic acid (Sigma-Aldrich Co., St. Louis, MO, USA) but sensitive to ciprofloxacin. The plasmid DNA was transformed into E. coli by electroporation using PEPTM (Personal Electroporation Pak Electroporator - BTX® Genetronics Inc) giving two electric pulses of 180 V at an interval of two seconds of each. The transformants were selected in LB agar (Himedia Laboratories Pvt. Ltd., Mumbai, India) containing Ciprofloxacin (Sigma-Aldrich Co., St. Louis, MO, USA) at a concentration of 1 μg/ml. These transformants were analysed further for antibiotic resistance pattern and PCR amplification. Results Fluoroquinolone resistance of Klebsiella pneumoniae clinical isolates from Chennai Clinical isolates of K. pneumoniae collected from Chennai in October 2009 were analysed for their resistance to the most commonly used fluoroquinolone antibiotics--ciprofloxacin and levofloxacin. It was found that 14 out of the 23 isolates (61%) of the ESBL isolates were resistant to ciprofloxacin, five out of 23 (22%) intermediately resistant and four (17%) were sensitive. The antibiotic levofloxacin was marginally better with 52% isolates resistant. The high resistance to fluoroquinolones is worrying and can compromise antimicrobial treatment. Association between MIC to Ciprofloxacin and the presence of qnr genes PMQR can be mediated by the qnr genes. In order to find out if these isolates harboured the qnrA and qnrB genes, a specific PCR was carried out from plasmids isolated from these isolates. In 16 out of 23 (70%) ESBL isolates, qnrA-specific PCR product [Figure - 1a] was observed. In 11 isolates (48%), qnrB gene was observed [Figure - 1b]. We were unable to amplify any product for the qnrS genes. Eight out of the 23 isolates (24%) had both qnrA and qnrB genes. In four isolates (12%), none of the qnr genes were present. The qnrA and qnrB amplified product from the isolate P13 was sequenced to confirm that it was the qnrA1 [Figure - 2]: GenBank Acc. No. HQ675013.1 and qnrB1 [Figure - 3]: GenBank Acc. No. HQ675012.1 allele, respectively. In order to correlate the fluoroquinolone resistance in the isolates with the qnr gene determinants, the minimal inhibitory concentration of ciprofloxacin for 19 resistant isolates was determined [Table - 1]. We found that two isolates showed MIC >240 μg/ml, while nine showed MIC >120 μg/ml. All the isolates which had an MIC >120 μg/ml were associated with either qnrA or qnrB or both genes. However, there were two isolates with an MIC of >60 μg/ml which were not associated with qnr genes. In addition, two fluoroquinolone-sensitive isolates harboured the qnr genes. Therefore, we wanted to find out if fluoroquinolone resistance was plasmid mediated and if there were other genes which could confer cumulative resistance. Transfer of quinolone resistance Since fluoroquinolone resistance can be chromosomal, plasmid mediated or a combination of both, we wanted to find out if the resistance in these isolates was plasmid borne. We chose two isolates P12 and P13 which carried both qnrA and qnrB genes and an MIC >120 μg/ml for further studies. Plasmid DNA from these two isolates was isolated and transformed into E. coli JM109 by electroporation. The transformants were selected on ciprofloxacin (1 μg/ml). Plasmid isolated from the transformants was analysed by qnr-specific PCR. [Figure - 4] shows the specific amplification of both qnrA and qnrB in the transformants. Furthermore, the minimum inhibitory concentration of ciprofloxacin in the transformants was determined. It was found that the E. coli transformants with the plasmid either from the P12 or P13 K. pneumoniae isolate showed an MIC of >240 μg/ml [Figure - 5]. The E. coli JM109 strain without the plasmids was sensitive to ciprofloxacin. This clearly shows that ciprofloxacin resistance is mediated by plasmids from these isolates. The transformants were also resistant to cefotaxime, a third-generation cephalosporin, suggesting that the ESBL resistance determinants may be carried in the transferred plasmid. Since the level of PMQR was high, we investigated whether any other quinolone resistance genes were present. Reports have shown that apart from the qnr genes, a variant of an aminoglycoside 6′-N-acetyltransferase, aac(6′)-Ib which confers resistance to tobramycin, amikacin and kanamycin can confer an incremental resistance to fluoroquinolones. [14] A mutant allele with the Trp102Arg and Asp179Tyr changes can acetylate ciprofloxacin resulting in resistance. To find out if the high level of fluoroquinolone resistance is due to the presence of this gene, we analysed the presence of aac(6′)-Ib by PCR. Screening for the aac(6′)-1b gene in Klebsiella pneumoniae isolates and identification of the cr mutant Plasmids isolated from 16 isolates including one ciprofloxacin-sensitive isolate was analysed by aac (6′) - 1b-specific PCR. Thirteen isolates showed the aac (6′) - 1b gene and three isolates did not amplify the gene [Figure - 6]. The E. coli JM109 transformants containing the plasmid pKNMGR12 or pKNMGR13 also showed the specific amplification. The amplified product of the aac (6′) - 1b from the plasmid pKNMGR13 was sequenced using an internal primer [Figure - 7]. This sequence contained the Trp102Arg and Asp179Tyr mutation confirming that this pNMGR13 contained the aac(6′) 1b-cr mutant which can confer ciprofloxacin resistance. The presence of this gene along with the qnrA and qnrB in the plasmid pKNMGR13 could be responsible for conferring higher level of ciprofloxacin resistance. It remains to be seen whether the aac(6′)-1b gene in other isolates carry the cr mutant of aac(6′) 1b. This is the first study reporting the presence of the aminoglycoside acetyl transferase gene aac(6′)-1b and the presence of the bifunctional ciprofloxacin-resistant variant in K. pneumoniae isolates from Chennai. Discussion This study screening for fluoroquinolone resistance in ESBL isolates of K. pneumoniae from Chennai collected in October 2009 showed that 61% isolates were resistant to ciprofloxacin and 52% to levofloxacin. In an earlier study from our laboratory analysing 188 isolates of K. pneumoniae, collected during November 2007 to October 2008, we had observed 52% isolates resistant to ciprofloxacin. A study on 48 ESBL K. pneumoniae isolates collected in January 1999 to December 2003 in a University hospital located in Rome, Italy, reported 48% isolates resistant to Ciprofloxacin. [16] Together, these data clearly show that fluoroquinolone resistance is increasing among K. pneumoniae isolates. The frequency of qnr genes in this study was found to be 69.5% for qnrA and 47.8% for qnrB. An analysis of the K. pneumoniae isolates obtained in the United States from 1999 to 2004 detected 14% qnrA and 6% qnrB in ceftazidime-resistant. [17] More recently, a study in clinical isolates of Enterobacteriaceae collected between 2001 and 2006 at Korea, 56.9% carried the qnr genes. [18] This is the first report after the discovery of the qnrA and qnrB gene from South India where a screening for both qnrA and qnrB has been reported from India. Although the resistant isolates did show the presence of the qnr alleles, among the four sensitive isolates, two harboured the qnrB allele and one harboured the qnr A allele. This could be due to the following reasons. The resistance to quinolones due to the presence of Qnr A is the result of Qnr binding to gyrase or topoisomerase IV at a site overlapping the DNA binding site for ciprofloxacin. The level of resistance conferred by the genes is believed to be a result of the copy number and the transcriptional level of the qnr genes. [19] Furthermore, the resistance can be cumulative due to the presence of other quinolone resistance genes. The plasmid borne nature of the quinolone resistance was shown for the isolates P12 and P13. Plasmids from the isolates P12 and P13 gave a very high MIC of 240 μg/ml to ciprofloxacin when transformed into the E. coli strain JM109. Since qnr genes are reported to give only a low level of quinolone resistance, [20] it is highly likely that these plasmids contain additional genes conferring quinolone resistance. AAC(6′)-Ib-cr, a variant aminoglycoside acetyltransferase capable of modifying ciprofloxacin and reducing its activity, has been reported to be widely prevalent and circulated together with qnr genes. [21] The complete nucleotide sequence of plasmid pKP96, which carries the PMQR determinants qnrA1, aac(6′)-Ib-cr and the blaCTX-M-24 ESBL coding gene from K. pneumoniae isolated in China [22] has been reported. This plasmid was found to contain a complex class 1 integron consisting of aac(6′)-Ib-cr, qacEdelta1, sul1, ISCR1, qnrA1, ampR, orf5 and orf6. Our analysis of the isolates revealed that 13 isolates out of 19 tested harboured the aac-(6′)-1b gene encoding aminoglycoside 6′-N-acetyltransferase, which confers resistance to amikacin, kanamycin and tobramycin and found to be broadly distributed geographically and present in many clinically important Gram-negative rods. [3] A variant, aac(6′)-Ib-cr, with the additional property of acetylating and inactivating fluoroquinolones with an accessible amino nitrogen on the piperazine ring, was described in 2006, encoded by a plasmid isolated in 2000-2001 from Shanghai. [6] The enzyme encoded by aac(6′)-Ib-cr differs from aac(6′)-Ib by only two amino acid substitutions, both of which are required for the enhanced substrate recognition. The "cr" variant was subsequently found to be widely distributed around the world. [3] Our results show the presence of the aac(6′)-1b gene in the Klebsiella isolates from Chennai and the presence of the cr variant in at least one of the isolates. This report is significant since this is the first report showing that PMQR is prevalent in K. pneumoniae in Chennai. Our earlier analysis on these isolates had shown the presence of the CTX-M gene and the IncF1C replicon in the plasmid pKNMGRP13. [23] Further complete sequencing of the resistance plasmid will be very important to identify the presence of genes such as qepA, an efflux protein conferring resistance to ciprofloxacin; the genetic context of the resistance genes which can give clues to the transfer mechanisms across species and the plasmid backbone carrying the resistance determinants. Acknowledgement This project was supported by a research grant from Council of Industrial and Scientific Research, India to Rama Vaidyanathan (No. 37(1385) 09/EMR-II (2009)). H. Magesh was supported by a Senior Research Fellowship from CSIR. References
Copyright 2011 - Indian Journal of Medical Microbiology The following images related to this document are available:Photo images[mb11064t1.jpg] [mb11064f5.jpg] [mb11064f1.jpg] [mb11064f7.jpg] [mb11064f6.jpg] [mb11064f2.jpg] [mb11064f4.jpg] [mb11064f3.jpg] |
| |||||||||
