 |
| About Bioline | All Journals | Testimonials | Membership | News |
|
||||||
|
||||||
Indian Journal of Medical Sciences, Vol. 59, No. 3, March, 2005, pp. 104-108 Original Article TNFR2 gene polymorphism in coronary artery disease Sankar V.H., Girisha K.M., Gilmour A., Singh V.P., Sinha N., Tewari S., Ramesh V., Mastana S., Agrawal Suraksha Department of Human Sciences, Loughborough University, Leicestershire Code Number: ms05015 Abstract BACKGROUND: Recently atherosclerosis and coronary artery disease (CAD) are considered to be inflammatory diseases. The genetic polymorphism in inflammatory markers has been well studied and found to be associated with development of CAD.AIM: To study the association of biallelic polymorphism at position 196 in exon 6 of tumor necrosis factor 2 (TNFR2) gene and coronary artery disease. SETTINGS AND DESIGN: The study design was a prospective case control study conducted at a tertiary referral center mainly catering to the north Indian population. MATERIALS AND METHODS: One hundred and fifty angiographically proven patients with coronary artery disease and one hundred and fifty age matched controls were genotyped for TNFR2 gene by polymerase chain reaction followed by analysis of restriction fragment length polymorphism. STATISTICAL ANALYSIS: Genotype frequencies were compared in patients and controls by Chi-square test. Binary logistic regression analysis was used to examine the relationship between genotypes and disease, incorporating other variables into the model. RESULTS: The incidence of CAD in those with MM genotype was 65% and in those with RM genotype was 42%. Genotype frequency shows significant association of MM genotype with development of CAD (P<0.001; odds ratio-2.585; 95% confidence interval 1.533-4.359). The association of TNFR2 genotype with CAD persisted on logistic regression analysis. CONCLUSION: MM genotype of TNFR2 gene is associated with development of CAD and RM genotype appears to be protective. KEYWORDS: Coronary artery disease, Atherosclerosis, Inflammatory markers, Genetics, Single nucleotide polymorphism, Tumor necrosis factor receptor type II INTRODUCTION Genetic predisposition and inflammation are two important factors in the development of atherosclerosis and coronary artery disease (CAD). Genetic variations in the mediators of inflammation may increase or decrease the risk of the coronary artery disease. There are some evidences which suggest that alteration in the genes coding for molecules which are involved in the inflammation may modify the risk of CAD.[1],[2],[3],[4] Proinflammatory cytokine tumor necrosis factor alpha (TNF-α) has been localized in atheromatous plaques and may contribute to the progression of atheroma by augmenting the inflammatory response.[5],[6] TNF-α exerts its effect via two receptors, TNFR1 and TNFR2. TNFR2 is increased in ischaemic heart disease and peripheral vascular diseases suggesting that the genetic variation in or near the TNFR2 gene may predispose to CAD.[7]TNFR2 gene is localized on 1p36.2 and comprises of 10 exons that span a region of 26 kb.[8] TNFR2 gene is a worthy candidate to study genetic predisposition for development of CAD as it is involved in the inflammatory response, which may lead to CAD. Various genetic polymorphisms in this gene have been described. A microsatellite marker in intron 4 is found to be associated with hypertension and familial hyperlipidemia.[9] Another marker has been found to be associated with obesity, leptin and insulin resistance in type 2 diabetes.[10] An association was found between a microsatellite marker, CA 16 repeats in exon 4 of TNFR2 gene and CAD whereas a biallelic polymorphism at 198 position in exon 6 is found not to be associated with CAD. [11],[12] Another biallelic polymorphism at position 196 is in exon 6, which causes a change of arginine to threonine. This has not been studied so far in CAD. This polymorphism is found to be associated with susceptibility to the autoimmune disease systemic lupus erythematosus in Japanese patients.[13], [14] In the light of these studies we have tested the role of TNFR2 polymorphism in predisposition to CAD. We hypothesize that the biallelic polymorphism at position 196 in exon 6 of TNFR2 gene may be associated with susceptibility to develop CAD. MATERIALS AND METHODS One hundred fifty consecutive angiographically proven coronary artery disease patients were included in the study, who were evaluated at the department of cardiology of a tertiary referral centre mainly catering to the north Indian population. Diagnosis of CAD was based on the presence of more than 50% stenosis in one of the coronary arteries. An experienced cardiologist performed angiography. One fifty healthy age matched controls from hospital staff were selected after a detailed evaluation of history, clinical features and investigations including a treadmill test to exclude the presence of CAD. Controls were not having any of the risk factors like family history of CAD, diabetes mellitus, hypertension and hyperlipidemia. Informed consent was obtained from all subjects and ethical clearance from the institute was taken to conduct this study.Genotyping: Genomic DNA was extracted from EDTA anticoagulated whole blood using salting out method. The primer sequences used for amplification of a 242 bp fragment of the TNFR2 exon 6 were as follows: Forward primer-5′ACTCTCCTATCCTGCCTGCT3′ and reverse primer -5′TTCTGGAGTTGGCTGCGTGT3′. (Invitrogen life technologies, UK) The final concentrations were: 0.4 µM of each primer, 1.25 units of Taq DNA polymerase, 75 mM Tris-HCl (pH 8.8 at 25°C), 20 mM (NH4)2SO4, 1.5 mM MgCl2, 0.01%(v/v) Tween 20 and 0.2 mM each of dATP , dCTP, dGTP, dTTP in each reaction tube. 1 µL of template DNA was added per reaction. Polymerase chain reaction (PCR) was performed using following conditions: 95 C for 5 minutes followed by 35 cycles of 94 oC for 1 minute, 64oC for 1 minute and 72oC for 2 minutes. Final extension step was carried out at 72oC for 5 minutes. PCR products were visualized on 2 % agarose gel electrophoresis at 120 V for 30 minutes to monitor amplification and possible contamination. NlaIII restriction enzyme was used for the digestion of the TNFR2 PCR products (New England Biotech, UK; concentration: 10,000U/ml. The substitution at codon 196 (ATG-AGG) correlated with the presence of an NlaIII restriction site on the M allele. The R allele does not have the restriction site. For the identification of 196M and 196R allele 3.5 αl of the PCR product was digested with 4 units of NlaIII, reaction buffer and 5 µg/ml BSA incubated at 37oC for 16 hours. Reaction buffer contained 50 mM potassium acetate, 20 mM tris acetate, 10 mM Magnesium acetate and 1 mM DDT at pH 7.9 at 25oC. The 242 bp PCR product was uncleaved in the 196R allele and cleaved into two fragments of 133 and 109 bp in 196M allele. Cooling on ice after 16 hours stopped digestion. The digested product was run on 4 % agarose gel at 120 V for 1 hour, stained with ethidium bromide and visualized under ultraviolet transilluminator. STATISTICAL METHODS Genotype and allelic frequencies were compared using Chi square test. Binary logistic regression analysis was done with disease status as binary outcome variable, accommodating other variables into the model. During statistical analysis RR genotype was not considered since its frequency was very low. All statistical tests were done by SPSS v 9.0 statistical software. P values of <0.05 were considered to be statistically significant.RESULTS Out of 150 individuals each in patient and control group, the genotype frequency was available in 147 patients and 147 controls as six samples failed to amplify. The clinical characteristics of the patient and control groups are shown in [Table - 1] and it is evident from the table that both groups were comparable demographically. The mean age with standard deviations of patient and control were 46.36±11.63 and 45.76±14.32 years respectively.Genotype distribution in patient and control groups is shown in [Table - 2]. The incidence of CAD in those with MM genotype was 65% and in those with RM genotype was 42%. The number with RR genotype was very small for comparison. Genotype frequency shows significant association of MM phenotype with the development of CAD (P<0.001; Odds Ratio-2.58; 95% Confidence Interval 1.53-4.35). However, there was no association seen between the allele frequencies and the disease (P >0.05). Logistic regression analysis was used to determine the relationship between the TNFR2 genotype and the disease with occurrence of disease as dependent variable with binary outcome [Table - 3]. The association of TNFR2 genotype with CAD persisted. The MM genotype of TNFR2 was significantly associated with occurrence of CAD (P=0.0078; Odds Ratio-2.72; Confidence Interval 1.30-5.69). The other factors associated with CAD are total cholesterol, high density lipoprotein cholesterol, very low density lipoprotein, apoprotein B level and smoking habit. The overall accuracy of the model for the prediction of the disease was 84.14%. DISCUSSION In the present study we have investigated the association of a biallelic polymorphism in TNFR2 gene with CAD. There is no convincing evidence in literature, which suggests the disease association of TNFR2 with CAD. This may be because very few studies are available. To the best of our knowledge, association of the biallelic polymorphism at codon 196 with CAD has not been reported earlier.Allen et al studied a biallelic polymorphism at codon 198 in exon 6 in 259 patients with CAD. Therea was no significant difference in allelic frequency and genotypes in healthy controls (0.23) vs. patients with CAD (0.24)[Odds Ratio- 1.1].[12] Benjafield et al studied the association of a microsattelite marker in TNFR2 gene with CAD and found a strong association of CA 16 allele in exon 4. The frequency of CA 16 allele was 33% in CAD vs. 21% in controls [P < 0.001; Odds Ratio- 4.5]. They have also found a strong association of CA 16 allele with overweight [P < 0.027: Odds Ratio- 1.44]. Plasma soluble TNFR2 was significantly high in CAD patient as compared to control population.[11] We have found that MM genotype occurs with a frequency of 65% in CAD group, which is significantly higher as compared to controls. This suggests a strong correlation of MM genotype of TNFR2 with development of CAD and RM genotype is found to be protective. The RR genotype is minimal; hence no conclusion could be deduced about the association. Binary logistic regression analysis also shows a significant association between TNFR2 genotype and development of CAD along with other factors. There is no published experimental evidence to confirm the potential functional effect of TNFR2 polymorphism. In a disease like CAD where multiple factors contribute to the pathogenesis, it is very difficult to find a single polymorphism as a susceptibility factor. Our study shows association of TNFR 2 gene with CAD; however further studies are required to confirm this finding for the better understanding of the genetic basis of the inflammatory process leading to atherosclerosis and CAD. References
Copyright 2005 - Indian Journal of Medical Sciences The following images related to this document are available:Photo images[ms05015t2.jpg] [ms05015t1.jpg] [ms05015t3.jpg] |
| |||||||||
![[Table - 1]](/showimage?ms/photo/ms05015t1.jpg){kind=link}
![[Table - 3]](/showimage?ms/photo/ms05015t3.jpg){kind=link}