 |
| About Bioline | All Journals | Testimonials | Membership | News |
|
||||||
|
||||||
Indian Journal of Medical Sciences, Vol. 62, No. 1, January, 2008, pp. 8-12 ORIGINAL CONTRIBUTION Identification of enteroaggregative Escherichia coli in infants with acute diarrhea based on biofilm production in Manipal, south India Bangar Raju, Ballal Mamatha Department of Microbiology, Kasturba Medical College, Manipal - 576 104, Karnataka Code Number: ms08002 Abstract Background: Enteroaggregative Escherichia coli (EAEC) is an emerging enteric pathogen that causes persistent diarrhea among infants, both in developing and industrialized countries. The EAEC strains adhere to epithelial cell surface, to the glass substratum and to each other in a distinctive stacked brick-formation. Thus, gold standard for identification of EAEC remains the HEp-2 cell adherence test, which is time consuming and requires specialized facilities.Aim: To evaluate the usefulness of quantitative biofilm assay to screen for EAEC from children with acute diarrhea. Materials and Methods: A total of 100 E. coli strains were collected from acute diarrheal cases from December 2005 to November 2006. The strains were screened for biofilm production using microtiter plate method. The biofilm in the microtiter plate was visualized after staining with crystal violet and was quantified using enzyme immunosorbent assay plate reader. The Aggregative plasmid and Heat stable toxin genes were evaluated by a multiplex polymerase chain reaction. The strains were identified as EAEC with an optical density at 570 nm (OD 570 ) > 0.2. Results: Of the total 100 Escherichia coli strains, 28 were positive by Polymerase Chain Reaction for two genes, AggR and EAST. Of the 28 PCR-positive strains screened for biofilm, 25 (89.2%) showed positive results by microtiter plate method. Conclusion: The quantitative biofilm assay using microtiter plate is convenient and economical and can be used as a screening method to screen E. coli isolates from acute diarrheal cases. The best use of this test is to screen large number of isolates quickly, and if positive this can be confirmed by multiplex PCR for AggR and EAST genes. This assay may contribute to demonstrating the true incidence of EAEC with and without AggR among clinically isolated E. coli strains, which can cause acute diarrhea. Keywords: Biofilms, diarrhea/polymerase chain reaction, enteroaggregative escherichia coli Introduction Escherichia coli is the predominant facultative anaerobe of human colonic flora. Some clones of this species are pathogenic. One of the major clinical syndromes to result from infection with pathogenic E. coli is enteric/gastrointestinal disease. Five major categories of diarrheagenic E. coli have been identified: enteropathogenic (EPEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), enterohemorrhagic. E. coli (EHEC) and enteroaggregative E. coli (EAEC). [1],[2] These categories are differentiated on the basis of pathogenic mechanisms and clinical manifestations. The importance of EAEC in diarrhea in children and in immunocompromised patients is well documented. Members of EAEC group are defined as E. coli strains that adhere to HEp-2 cells in an aggregative pattern. Most E. coli strains that belong to EAEC category have been found to be serologically nontypable using standard methods. [3],[4],[5] The pathogenesis of EAEC infection is only partially understood. In several in vivo and in vitro models, EAEC strains adhere to the small and large bowel mucosal surface in a thick aggregating biofilm. The gold standard for identification of EAEC remains HEp2 cell adherence test, which is time consuming and requires specialized facilities. We evaluated the usefulness of a quantitative biofilm assay to screen for EAEC from a total of 100 E. coli strains from children with diarrhea. Although confirmation by multiplex PCR is needed, the biofilm assay is convenient and useful in screening for EAEC among clinical isolates of E. coli. Materials and Methods A total of 100 E. coli strains from children with acute/persistent diarrhea were isolated in a bacteriological laboratory from December 2005 to November 2006. Only one stool specimen was tested from each case patient. All specimens were processed by routine microbiologic and biochemical tests in the bacteriological laboratory to identify E. coli. Mac Conkey′s agar was used as a primary media. All E. coli-like colonies from a single stool specimen with identical colony morphology and biochemical properties were assumed to be identical; if isolates were found to be identical, only one colony was analyzed further from that specimen. Strains of E. coli were stabbed into semisolid nutrient agar butts and were stored at -20°C till further investigation. Quantitative biofilm assay To assess biofilm formation, we inoculated 200μl of 0.45% glucose-rich Muller-Hinton broth in 96 well-bottom microtiter polystyrene plates (NUNC, Immunomodules) with 5 μl of an overnight Luria broth culture grown at 37°C with shaking. The sample was incubated overnight (18 h) at 37°C and visualized by staining with 0.5% crystal violet for 5 min after washing with water. The biofilm was quantified in duplicate after adding 200 μl of 95% ethanol by an enzyme-linked immunosorbent assay plate reader at 570 nm. Strain 042 was used as positive control, and E. coli HB 101 was used as negative control. Detection of AggR gene by multiplex PCR All 100 E. coli strains were examined for the detection of AggR gene by a PCR. Each PCR tube contained 50 μl of reaction mix (10x PCR buffer with MgCl 2 ; dNTP mix 2.5 mm each; 4 primers 10 mm each), which comprised of AggR 5′ CTGGCGAAAGACTGTATCAT′ 3 + 5′ CAATGTATAGAAATCCGCTGTT′ 3 and for east 5′CACAGTATATCCGAAGGC′ 3 + 5′ CGAGTGACGGCTTTGTAG′ 3, template lysate, sterile water, Taq polymerase (5 U/μl), and total volume was made up to 50 μl. The solutions were then subjected to the following cycling conditions: denaturation 94°C/1 min, annealing 55°C/1 min, extension 72°C/1 min, final extension 72°C/7 min in a thermal cycler. Then 10 μl of the PCR mixture was visualized by ethidium bromide staining after electrophoresis in 2% agarose gel in tris acetate-ethylene diamine tetra acetic acid buffer. Statistical analysis Statistical analysis was performed using the Fishers Exact Probability Test. P-values < 0.05 were considered significant. Results Of the total 100 E. coli isolates from infants with acute diarrhea, 28 were confirmed to be EAEC due to the fact that they showed the specific bands against AggR (630 bp) and EAST (97 bp) by multiplex PCR using specified primers. To assess the biofilm formation of these 28 proven EAEC strains, they were inoculated by standard procedure and were assessed for the ability to form biofilm by quantitative microtiter plate assay. Twenty-five (89.2%) out of 28 produced biofilm in the microtiter plate. The EAEC 042 positive control showed a strong biofilm with a + standard deviation optical density at 570 nm (OD 570 ) of 2.0 + 0.34, while the E. coli HB 101 negative control did not produce a biofilm. The test strains showed absorbances in the range of 0-1.9. All EAEC strains showed absorbances> 0.2. EAEC showed significantly stronger biofilm than did non-EAEC strains (P = 0.001). Discussion Looking back, research on biofilms has come a long way since the initial characterization of a biofilm by Antoni Von Leeuwenhoek. The pathogenesis of EAEC is presently being defined. The major obstacle in identifying the mechanism of pathogenesis for EAEC is the diversity and heterogeneity of strains. [6],[7],[8] EAEC has been clearly associated with diarrhea in some individuals; but in many others, EAEC strains appear to cause sub-clinical infections or intestinal colonization. These bacteria exert a complex pathogen-host immune interaction. The current studies on EAEC pathogenesis suggest the presence of three stages: (1) adherence to intestinal mucosa by aggregative adherence fimbriae (AAF) or other organism-adherence factors; (2) increased production of mucus by the bacteria and the host cell which is deposited as a mucous biofilm encrusted with bacteria on the surface of enterocytes and (3) an inflammatory response with cytokine release, mucosal toxicity and intestinal secretion. [9],[10] Numerous virulence factors that allow EAEC to adhere to intestinal mucosa have been reported to be important. The pathogenesis of EAEC involves the production of a mucous layer probably from contributions of both bacteria and intestinal mucosa. This thick mucus-containing biofilm is encrusted with EAEC on the surface of enterocyte. This mucus-containing biofilm may explain why individuals infected with EAEC develop mucoid stools, malnutrition and persistent colonization with prolonged diarrhea. [11],[12],[13] EAEC strains in population around the world are becoming increasingly clear. The EAEC strains have been associated classically with persistent diarrhea (>14 days) and with growth retardation in infants. This pathogen has currently not been identified except in a small number of research laboratories. Therefore, there is a need for convenient assay to detect EAEC. [14],[15],[16] We applied the quantitative biofilm assay using microtiter plate to screen for EAEC among E. coli isolated from children with acute/persistent diarrhea. [15],[16],[17],[18] All EAEC strains in this study showed an OD 570 > 0.2 in the assay, and the incidence of EAEC among the strains with an OD 570 > 0.2 was 89.2%. Although confirmation by PCR test is needed to identify EAEC, this biofilm assay is convenient and useful in screening of EAEC. In particular, it is more convenient when a large number of strains are examined in clinical and epidemiologic studies. [19],[20],[21] This assay may be more useful in developing countries, where EAEC is often a major problem. Furthermore, the test may be available without a spectrophotometer, since a biofilm showing an OD 570 > 0.2 is clearly visible. In addition, this assay may contribute to demonstrating the true incidence of EAEC with and without AggR among clinically isolated E. coli strains. Acknowledgments We thank the Centre for Scientific and Industrial Research (CSIR, New Delhi, India) for funding the above work.References
Copyright 2008 - Indian Journal of Medical Sciences |
| |||||||||
