 |
| About Bioline | All Journals | Testimonials | Membership | News |
|
||||||
|
||||||
Neurology India, Vol. 55, No. 4, October-December, 2007, pp. 408-409 Case Report Severe phenytoin toxicity in a CYP2C9*3*3 homozygous mutant from India Kesavan Ramasamy, Sunil K. Narayan*, Shashindran Chanolean, Adithan Chandrasekaran Departments of Pharmacology and *Neurology, Jawaharlal Institute of Medical Education and Research, Dhanvanthari Nagar, Pondicherry - 6,
India Date of Acceptance: 31-Jan-2007 Code Number: ni07120 Abstract The authors report an Indian adult female patient with a history of generalized tonic clonic seizures who developed severe features of phenytoin (DPH) toxicity on therapeutic dosage of this antiepileptic drug. Administration of 300mg/day of DPH in this patient resulted in toxic symptoms associated with an excessive serum DPH concentration of 33μg/ml. The PCR-RFLP analysis revealed a homozygosity involving CYP2C9*3*3. This mutation results in a marked decrease in the enzymatic activity (CYP2C9) and leads to a decreased clearance of the drug which can lead to severe acute and chronic toxicity. On switching the antiepileptic therapy from DPH to sodium valproate, there was reversal of both.Keywords: CYP2C9 polymorphism, phenytoin toxicity Phenytoin / Diphenyl hydantoin (DPH) is a well-established, widely prescribed first line drug for the treatment of simple and complex partial seizures as well as generalized seizure. It is metabolized by cytochrome P450 enzyme CYP2C9 (90%) and CYP2C19 (10%). The rate of metabolism of DPH is genetically determined and varies by ethnicity and race. In the Tamil Nadu population, the frequency of CYP2C9 alleles viz. CYP2C9FNx011, CYP2C9FNx012, CYP2C9FNx013 has been established. The distribution of CYP2C9FNx012 and FNx013 mutant alleles in our population (0.04 and 0.08) was less than that of the Caucasians (0.12 and 0.08) but more than that of Orientals (0.00 and 0.03). [1] The mutant alleles of CYP2C9FNx012(29%) and CYP2C9FNx013(95%) have lower enzymatic activity compared with wild (normal) type CYP2C9FNx011. [2] Owing to its zero order (nonlinear) pharmacokinetics and a narrow therapeutic window, DPH may reach high level in the individual possessing mutant alleles ( CYP2C9FNx012 and CYP2C9FNx013 ), which results in precipitation of adverse effects at the conventional dosages. Though association of CYP2C9 genetic polymorphism with adverse effects of DPH has been well documented in ethnic groups such as Caucasians and Orientals, [3],[4],[5] this is the first report addressing the influence of CYP2C9 genetic polymorphism on DPH toxicity in any Indian patient. Case Report A 22-year-old lady (weight, 38kg; height, 145cm) had been on long-term DPH therapy (12 months) for primary generalized epilepsy at a variable daily dose of 200-300-mg/day. Though she was advised sodium valproate initially, this had to be replaced by DPH since the patient could not afford the former while the latter was freely supplied in the hospital. In July 2002, she was hospitalized with adverse effects and poor compliance of DPH with resultant poor control of seizures. On neurological examination, this patient was found to have nystagmus, ataxia and excessive sedation. Physical examination also revealed lymphadenopathy, pain and deformity of multiple bones, anemia, hirsutism, acne and gum hypertrophy (Grade III). Skeletal survey revealed multiple fractures at various stages of healing along with features suggestive of osteomalacia. Hemoglobin level, plasma albumin level and body mass index (BMI) were 6.5 gm %, 3.3 g/dl and 18.1 respectively. Phenytoin (DPH) toxicity was suspected and plasma DPH was estimated in the patient by reverse phase HPLC method as described by Gerson et al . [6] The DPH level was 33.2 mg/L at prescribed dosage of 300 mg/day of DPH over the preceding one month period. The DPH was stopped and the acute toxicity symptoms subsided immediately. The DPH was substituted with sodium valproate whose compliance was monitored and ensured without any adverse effects. Over a period of six months, seizures remained well controlled. Clinically, gum hyperplasia (Grade I), acne, hirsutism and anemia had also reversed significantly. The clinical and plasma level evidences of DPH toxicity prompted appropriate pharamacogenomics studies. Patient′s DNA was extracted from peripheral blood leucocytes by conventional phenol-chloroform method and genotyping of CYP2C9 for FNx011, FNx012 and FNx013 alleles was performed by a polymerase chain reaction - restriction fragment length polymorphism (PCR-RFLP) method. [7] The CYP2C9FNx012 (Arg144Cys) was detected using the forward and reverse primers 5′ TACAAATACAATGAAAATATCATG 3′ and 5′ CTAACAACCAGA CTCATAATG 3′, respectively.′ The amplified PCR products were digested with 5 U restriction enzymes AvaII by overnight incubation at 37˚C. The detection for CYP2C9FNx013 (Ile359Leu) was performed using two separate mismatched forward PCR primers 5′AATAATAATATGCACGAGGTCCAGAGATGC 3′ and 5′ AATAATAATATGCACGAGGTCCAGAGGTAC 3′ and an intron 7 reverse primer 5′ GATACTATGAATTTGGGACTT C3 ′. The first mismatched primer introduced an NsiI site in Ile359 and the second mismatched forward primer introduced a KpnI site in Leu359 alleles. The amplified PCR products were digested with 5 U restriction enzymes NsiI and KpnI by overnight incubation at 37˚C. The digested PCR products were separated by electrophoresis using an 8% polyacrylamide gel and stained with ethidium bromide. Samples containing CYP2C9FNx011 allele produced 521-bp and 169-bp after digestion with Ava II, while those containing CYP2C9FNx012 allele were not digested. Normal alleles produced 112-bp and 29-bp fragments after NsiI digestion and CYP2C9FNx013 mutant allele produced 111-bp and 30-bp fragments after KpnI digestion. Discussion A 22-year-old lady with epilepsy on chronic DPH therapy had definite features of acute DPH toxicity at hospitalization which was documented by plasma DPH estimation as well. In addition, she also had clinical features such as lymphadenopathy, acne, hirsutism and gum hyperplasia (Grade III) [8],[9] which are well-known adverse effects of long-term DPH therapy. Multiple bone fractures in this young lady are unlikely to be due to convulsions and falls alone and more likely to be pathological features secondary to hypovitaminosis D, another recognized DPH adverse effect. Though the anemia was not evaluated fully, there is a possibility of megaoblastosis due to DPH-induced folate deficiency. Thus it appears that she had severe chronic DPH toxicity as well. The DPH drug level at hospitalization was estimated to be 33.2 mg/L and genotype result was found to be homozygous CYP2C9FNx013FNx013 . After switching from DPH to sodium valproate, seizures remained well controlled and her acute toxicity symptoms disappeared. On follow-up for six months, there was a significant reduction in the chronic toxicity features as well. It was obvious that DPH was not to be the drug of choice for primary generalized epilepsy in this patient. Pharmacogenomics studies before initiating antiepileptic therapy could have easily identified the unfavorable genotype of CYP2C9, a major DPH metabolizing enzyme in this case, and prompted the physicians to choose and convince the patient on the need for an alternate antiepileptic drug such as sodium valproate. This would have avoided a number of iatrogenic complications of antiepileptic drug therapy in this case, which resulted in poor drug compliance and poor seizure control as well. The fact that the same enzyme also metabolizes drugs like warfarin, tolbutamide, losartan, diclofenac etc adds to the value of this genotyping since many elderly epileptic patients have co-morbidity and could be candidates for co-prescription with these drugs as well. We recommend that wherever possible, the clinicians may do CYP2C9 genotyping of the epileptic patients before prescribing DPH. References
Copyright 2007 - Neurology India |
| |||||||||
