search
for
 About Bioline  All Journals  Testimonials  Membership  News  Donations


Revista Colombia Médica
Universidad del Valle - Facultad de Salud
ISSN: 0120-8322 EISSN: 1657-9534
Vol. 35, Num. 1, 2004, pp. 22-30

Revista Colombia Médica, Vol. 35, No. 1, 2004, pp. 22-30

Estudio de la seroprevalencia de la infección por los virus linfotrópicos humanos (HTLV) I y II en poblaciones del departamento de Córdoba, Colombia

Milton Quintana, M.Sc.1, Julio Villalobos, M.D.2, Martha C. Domínguez, M.Sc.3, Oscar Tamayo, M.Sc.4, Felipe García-Vallejo, Ph.D.5

  1. Director de Investigaciones, Facultad de Medicina, Corporación Universitaria del Sinú, Montería.
  2. Profesor Titular, Facultad de Medicina, Corporación Universitaria del Sinú, Montería.
  3. Investigadora Asociada, Laboratorio de Biología Molecular y Patogénesis, Escuela de Medicina, Departamento de Ciencias Fisiológicas. Aspirante a Doctora en Ciencias Biomédicas, Facultad de Salud, Universidad del Valle, Cali.
  4. Profesor Asistente, Facultad de Medicina, Universidad Santiago de Cali, Cali.
  5. Profesor Titular y Director del Laboratorio de Biología Molecular y Patogénesis, Departamento de Ciencias Fisiológicas, Escuela de Medicina, Facultad de Salud, Universidad del Valle, Cali.

Recibido para publicación septiembre 1, 2003
Aprobado para publicación febrero 6, 2004

Code Number: rc04005

RESUMEN

Introducción: Se determinó la seroprevalencia de los virus linfotrópicos humanos tipos I y II (HTLV-I y II) en varios municipios del Departamento de Córdoba.
Materiales y métodos: Se analizaron 962 muestras de suero mediante la prueba de ELISA y de Western blot confirmatorio. Se analizaron genéticamente 5 aislamientos virales por RFLP y secuenciación de la región LTR.
Resultados: Se confirmaron 20 aislamientos como HTLV-I y uno como HTLV-II. La seroprevalencia de la infección por el HTLV-I en la muestra obtenida del departamento de Córdoba fue 2.1% (20/962), y para el HTLV-II 0.1% (1/962). Mediante análisis genéticos se determinó que tres correspondieron al subtipo africano b y dos el cosmopolita a.
Conclusión: Este es el primer registro de la infección tanto por HTLV-I como por HTLV-II informado para el departamento de Córdoba en Colombia.

Palabras clave: HTLV-I. HTLV-II. Epidemiología. Subtipos moleculares.

SUMMARY

Introduction. We studied the seroprevalence of human lymphotropic virus (HTLV) types I and II infection in several towns of the Department of Cordoba in the Colombian Caribbean region.
Materials and methods. By ELISA and Westen blot we screened a total of 962 sera. From proviral PBMC DNA of five HTLV-I seropositive individuals RFLP and sequencing of LTR region was performed.
Results. Twenty samples were confirmed as HTLV-I and one as HTLV-II. The seroprevalence for HTLV-I in the sample of the department of Cordoba was 2.07% (20/962) and 0.104% (1/962) for the HTLV-II. The genetic analysis showed that three isolates were classified as West African b and two as Cosmopolitan a.
Conclusion. The present is the first report of HTLV-I and II infection in towns of Cordoba Department in Colombia.

Key word: HTLV-I. HTLV-II. Epidemiology. Molecular subtypes. 

El grupo de los virus linfotrópicos humanos (HTLV) tiene dos miembros bien descritos, los tipo I y II. El HTLV-I fue el primer retrovirus patogénico que se identificó en humanos aislado de un paciente con linfoma cutáneo1,2. Luego, en 1982, se aisló el HTLV-II de un tipo de leucemia rara, conocida con el nombre de leucemia de células pilosas3. En la actualidad el HTLV-I se encuentra asociado con un gran número de desórdenes clínicos. Sin embargo, la leucemia de las células T del adulto (ATL)4-6 y la paraparesia espástica tropical o mielopatía asociada con el HTLV-I (PET/HAM)7-9, son las asociaciones epidemiológicas mejor documentadas.

Tanto la infección por el HTLV-I como por el HTLV-II es endémica en varias áreas geográficas del mundo, incluyendo el suroeste de Japón10,11 y la cuenca del Caribe12,13; en América del Sur en regiones como Chile14, Brasil15 y Colombia16,17 entre otras. También se ha informado en África Occidental18,19 y Central20,21, las Islas Seychelles, Papua Nueva Guinea e Islas Solomon22-25, Australia26, Taiwán27 e India28. Recientemente se han documentado nuevos casos de la infección en países como China29, EEUU30, Inglaterra31, Argentina32 y en zonas del Medio Oriente como Israel33, Irán34 y Kuwait35. En todos los análisis epidemiológicos realizados se puede ver que el patrón de distribución de la infección por el HTLV-I es amplio, destacándose zonas endémicas en diferentes partes mundo.

La transmisión del HTLV-I está estrechamente asociada con la exposición de células blanco al virus. Se ha documentado en varios trabajos36,37 que una vía importante de transmisión ocurre de madre a hijo a través de linfocitos infectados con el virus presente en la leche materna; ésta es una característica propia de áreas endémicas para la infección. La transmisión sexual es también un factor importante, con un mayor riesgo de transmisión de hombre a mujer a través de células infectadas presentes en las secreciones genitales38,39. La fuerte agregación familiar de la infección con este virus, ha sugerido que las dos vías anteriores contribuyen a mantener el estado endémico de la infección. Sin embargo, la transfusión sanguínea y el intercambio de agujas infectadas con el virus (drogadictos intravenosos, tatuajes, etc.) se asocian con brotes epidémicos en algunas áreas urbanas de los Estados Unidos y Europa.

Los métodos, como el análisis del patrón de restricción de los fragmentos amplificados por PCR (RFLP) y la secuenciación de segmentos del ADN proviral, son útiles en el conocimiento de la variación genética y en el comportamiento de la infección por el virus40,41. Mediante análisis de RFLP en la región 3’LTR y de secuenciación de la región env se han discriminado genéticamente varios subtipos del HTLV-I. El estudio detallado de la distribución geográfica de los distintos subtipos del virus, permite obtener importantes conclusiones en relación, no sólo con la epidemiología molecular de la infección viral sino con el esclarecimiento de los mecanismos evolutivos de los virus en áreas endémicas para la infección por el virus.

En el presente trabajo se efectuó un estudio poblacional para determinar la seroprevalencia de la infección por HTLV-I y II en poblaciones del departamento de Córdoba. Los resultados obtenidos permiten analizar el comportamiento epidemiológico de la infección por estos dos retrovirus humanos en esta región del Caribe colombiano. Además se obtuvieron datos moleculares sobre los subtipos virales circulantes.

MATERIALES Y MÉTODOS

Población estudiada. Durante el período junio, 1998 a enero, 2000 se recolectaron 962 muestras de suero de personas de diferentes localidades de las zonas costaneras del departamento de Córdoba. El tamaño muestral apropiado se calculó con base en el programa Epi Info versión 6.0. Los sueros provenían de 298 hombres y 664 mujeres con edades que variaron entre 17 y 70 años (mediana=28 años) obtenidos de voluntarios que acudieron mediante perifoneo, a los puestos de salud y hospitales de cada uno de los municipios incluidos en el estudio. Del total de muestras, 420 se tomaron en Montería (300 mujeres y 120 hombres), 168 en San Antero (110 mujeres y 58 hombres), 127 en Cereté (81 mujeres y 46 hombres), 112 en San Pelayo (79 mujeres y 33 hombres), 69 en Moñitos (48 mujeres y 21 hombres), 42 en San Bernardo del Viento (32 mujeres y 10 hombre), 16 en Lorica (9 mujeres y 7 hombres), 5 en Sahagún (3 mujeres y 2 hombres); 2 en Cotorra (2 hombres) y una proveniente de Coveñas (1 hombre) en el departamento de Sucre. A cada participante incluido en el estudio se le informó previamente los objetivos y firmaba su consentimiento para participar voluntariamente en él.

Obtención de las muestras de sangre. A cada una de las personas que voluntariamente aceptaron participar en este estudio se le tomó por venopunción, una muestra de 10 ml de sangre total. Una vez obtenido el suero se almacenó a -20º C hasta su utilización. De otra parte las células mononucleares de sangre periférica (PBMC) se obtuvieron por centrifugación en gradientes de Histopaque y luego se almacenaron en solución de buffer salino de fosfato (PBS) pH 7.0 en 50% de dimetil sulfoxido (DMSO), a -196º C en nitrógeno líquido.

Pruebas serológicas. Cada una de las muestras de suero se sometió a una prueba de micro ELISA utilizando el estuche ELISA Murex HTLV I + II (Murex Biotech Limited, Dartford, UK). La ejecución de la prueba se efectuó siguiendo las recomendaciones de los fabricantes.

Seroconfirmación de la infección por HTLV-I o II. Las muestras de suero que fueron reactivas por la prueba de tamizado se sometieron a la prueba confirmatoria de Western blot. Para esto se utilizó el estuche Inmunblot HTLV blot 2.4 (Genelabs® Diagnostics Pte Ltd. Singapore Science Park, Singapore). La prueba de Western blot permite realizar una discriminación entre la infección por HTLV-I y de HTLV-II porque emplea dos proteínas recombinantes: la rpg46.1 confirma la infección por HTLV-I mientras que la rpg46.2 lo hace para HTLV-II. El criterio de confirmación para HTLV-I incluyó reactividad para las proteínas de GAG (p24 ó p19) y ENV (GD21 y rpg46.1). Para la confirmación de la infección por HTLV-II se utilizó como criterio la reactividad a GAG (p24 con o sin p19) y ENV (rpg46.2 y GD21). Los criterios antes descritos fueron aplicados a todas las muestras reactivas por las pruebas de tamizado.

La seroprevalencia de HTLV-I y II en la muestra se calculó como el cociente entre el número de individuos seropositivos para cada uno de los virus y el número total de muestras analizadas.

Protocolos moleculares. Las células mononucleares de sangre periférica se lisaron por tratamiento con dodecil sulfato de sodio (SDS) 1%, NaCl 1M y proteinasa K (20 mg/ml) incubando la preparación toda la noche a 56º C. El ADN celular se extrajo empleando protocolos modificado por el Laboratorio de Biología Molecular y Patogénesis, Universidad del Valle42,43. La concentración y el grado de pureza se determinó por espectrofotometría, la lectura se efectuó a 260/280 nm. Para la extracción del ADN de cada una de las muestras se tomaron precauciones estrictas con el fin de evitar contaminación (la extracción del ADN se efectuó en grupos de 4 muestras y en un lugar diferente al sitio de amplificación).

Amplificación por PCR del ADN proviral del HTLV-I. Primero se efectuó una reconfirmación por PCR de las muestras HTLV-I evaluadas serológicamente amplificando un fragmento de 186 pb del gen Pol con cebadores específicos. De igual forma se hizo la reconfirmación de la infección por HTLV-II empleando cebadores específicos del gen en la envoltura43.

Para hacer el análisis genético por RFLP de los aislados virales se realizó un PCR en un segmento de 701 pb de la región 5’LTR del ADN proviral extraído de linfocitos de sangre periférica. Se utilizaron oligonucleótidos cebadores (LTR1 (+) (37-738) LTR1 (ACCATG AGCCCAAATATCCCC),LTR2 (AA TTTCTCTCCTGAGAGTGCTATA). El oligonucleótido cebador LTR3 (CAT AAGCTCAGACCTCC) se empleó como sonda en experimentos de hibridización en Southern. Las muestras de ADN se amplificaron en un termociclador (Perkin-Elmer Cetus, modelo 4800); se efectuó un paso de desnaturalización previo por 5 minutos a 94° C, seguidos por 35 ciclos conformados por un paso de desnaturalización por un minuto a 94º C, uno de alineamiento a 50º C y un paso final de extensión a 72º C por dos minutos; finalmente, se efectuó un ciclo adicional de extensión a 72º C por 10 minutos, tiempo necesario para permitir que la Taq polimerasa complete la polimerización de los fragmentos incompletos. Se emplearon 10 microlitros de cada producto de PCR para visualizar las bandas amplificadas de acuerdo con su tamaño molecular, mediante electroforesis en gel de agarosa al 1%.

El segmento de 701 pb de la región LTR se digirió con las enzimas Apa I y Nde I (GIBCO, BRL), que definen los perfiles de restricción para el subtipo I, Mae III y Dra I (Promega) para el subtipo cosmopolita y Sac I (GIBCO BRL) para el subtipo africano occidental40,41. Los fragmentos resultantes se separaron de acuerdo con el tamaño molecular empleando análisis electroforético en un gel de agarosa del 3% siguiendo la metodología de Sambrook et al.44 Los fragmentos producidos por las digestiones de las diferentes endonucleasas de restricción previamente descritas, se analizaron mediante la observación del patrón de bandas generadas y comparadas con el prototipo MT-2. Para el análisis estadístico de los resultados se aplicó la prueba de Fisher para establecer la relación entre el sexo y el estado clínico de los pacientes con los subtipos encontrados en este estudio.

Protocolos de clonación y secuenciación de ácidos nucleicos. El fragmento de 701 bp de la región LTR obtenido de cada uno de los aislados del HTLV-I se caracterizó mediante electroforesis en gel de agarosa del 2%. Luego se empleó el estuche QiaGen® de elución de bandas siguiendo los procedimientos recomendados por los fabricantes. Cada uno de los fragmentos eluidos se clonó en el sitio Hind III del vector pCR2.1 (Invitrogen®). Los clones recombinantes se seleccionaron de acuerdo con lo descrito por Sambrook et al.44

Para la secuenciación de la región LTR se escogieron tres recombinantes de cinco aislados del HTLV-I (002-Mont, 022-Mont, 047-Mont, 010-Mont y 046-Mont), se utilizó el estuche Big Dye Terminator (QiaGen®), siguiendo las recomendaciones de los fabricantes. La secuenciación se realizó empleando la metodología de secuenciación cíclica utilizando un secuenciador automático AbiPrism serie 3700.

Análisis filogenético. Las secuencias nucleotídicas de la región LTR de cinco aislados de la población de Moñitos y de otras previamente consignadas en el GeneBank (Cuadro 1) se alinearon usando el programa Clustal W45. Para el análisis filogenético molecular de cada una de las secuencias LTR, se emplearon tres algoritmos: la evolución mínima distancia-base (ME), la probabilidad máxima (ML), y la parsimonia máxima (MP)46. Cada árbol se evaluó estadísticamente mediante la prueba de Bootstrap empleando 500 repeticiones.

Caracterización del ADN mitocondrial. Con el fin de definir el origen étnico de los individuos portadores del HTLV-I en el departamento de Córdoba, se determinaron los haplotipos mitocondriales, mediante un análisis de polimorfismo del tamaño de fragmentos de restricción (RFLP), utilizando para ello los oligonucleótidos cebadores descritos por Torroni et al.47 Para la diferenciación de los haplotipos se utilizaron 14 enzimas de restricción (AluI, AvaII, BamHI, DdeI, HaeII, HaeIII, HhaI, HincII, HinfI, HpaI, MspI, MboI, RsaI y TaqI). De acuerdo con la combinación de patrones de restricción con enzimas marcadoras, cada individuo incluido en este estudio, se agrupó en uno de los 19 diferentes haplogrupos que se han identificado hasta el presente en las poblaciones humanas. De esta manera se pudo definir genéticamente la etnia a la que pertenece cada uno. El haplogrupo L donde se incluyen los africanos, se define por tener un sitio nuevo de HpaI en la posición 3592. Los descendientes de europeos se diferencian por tener un sitio de DdeI en la posición 10394. Los descendientes de asiáticos y nativos amerindios, grupo M, se diferencian por la presencia de un sitio AluI en la posición 10397.

RESULTADOS

Determinación de la infección del HTLV-I. De las 962 muestras analizadas mediante micro ELISA, un total de 24 sueros mostraron valores de OD mayores de 15% del valor del punto de corte calculado para cada una de la pruebas efectuadas; éstas se consideraron como reactivas para HTLV-I/II.

Seroconfirmación de la infección por HTLV-I y HTLV-II. La prueba de Western blot confirmó como HTLV-I a 83.3% (20/24) de las muestras que fueron reactivas por las pruebas de micro ELISA (Gráfica 1A). Una de las muestras (código 0725) perteneciente a un hombre mestizo de 65 años proveniente de Moñitos, mostró un patrón de Western blot compatible con el de la infección por HTLV-II (Gráfica 1B); reconfirmó este resultado el análisis de PCR con cebadores específicos para el HTLV-II.

Las mayores frecuencias de infectados por el HTLV-I se determinaron en los rangos de edad entre 20 y 30 años (35%) y entre 31 y 40 años de edad (40%) (Cuadro 2). Del total de la muestra 55% (11/20) de los seropositivos eran mestizos, 30% (6/20) negros y el resto caucásicos (Cuadro 2). Tres de las muestras clasificadas como HTLV-I pertenecían a pacientes con PET/HAM. La seroprevalencia total de la infección por el HTLV-I en la muestra poblacional del departamento de Córdoba fue 2.1% (20/962), mientras que para el HTLV-II fue 0.1% (1/962). Para cada una de las localidades muestreadas, se determinaron frecuencias variables de seropositivos para el HTLV-I (Cuadro 3).

Caracterización molecular de aislados del HTLV-I. El ADN de linfocitos de cinco personas seropositivos se sometió a análisis molecular para determinar el subtipo. De ellos 3 se incluyeron en el subtipo africano b y dos en el cosmopolita a. El alineamiento de una región de 660 pb de las secuencias LTR obtenidas mostró un porcentaje equivalente de nucleótidos A, G, C y T (25%). En total se registraron 27 sustituciones puntuales cuyas frecuencias fueron: A-->T (9/27), -->T (4/27), C-->G (6/27), A-->C (1/27), A-->G (4/27) y T-->G (3/27) (Gráfica 2).

El análisis filogenético de la región LTR usando los tres métodos diferentes, mostró agrupaciones con topologías muy similares. En la Gráfica 3 se presenta el árbol filogenético enraizado obtenido mediante el método NJ; en éste se observó que el subtipo cosmopolita o HTLV-Ia está separado de los subtipos HTLV-Ib, HTLV-Ic y HTLV-Id, presentando valores de bootstrap de 74% para NJ y 86% para MP que son significativos.

Gráfica 4

Los aislados colombianos del departamento de Córdoba incluidos en este trabajo, se ubicaron dentro del subgrupo B o japonés, mostrando gran divergencia con aquellos aislados de indígenas colombianos previamente informados que se incluyeron dentro del subgrupo A o transcontinental. Este nuevo agrupamiento de aislados colombianos incluidos dentro del subgrupo japonés, presentó valores de bootstrap de 100% para NJ y 99% para MP que fueron significantes.

DISCUSIÓN

En este estudio se analizó la infección por los virus linfotrópicos humanos tipos I y II en zonas costeras e interiores de la región occidental de la costa Caribe colombiana. El registro de la infección tanto por HTLV-I como por HTLV-II en poblaciones del departamento de Córdoba, es un aspecto que contribuye al entendimiento de la epidemiología de la infección por estos dos retrovirus humanos.

La mayoría de los trabajos epidemiológicos sobre la infección por el HTLV-I en Colombia se ha realizado en la costa pacífica y la región central. En ellos se documenta de forma detallada la existencia de zonas endémicas en la costa pacífica (Tumaco, Guapi y Buenaventura) donde las seroprevalencias varían de 1.1% a 2.8 %16,17. Sin embargo, en comparación con los estudios realizados en la costa pacífica hasta el momento de realizar este trabajo, existían muy pocos estudios epidemiológicos que documentaran la circulación de estos virus en las poblaciones caribeñas colombianas48-50.

El presente estudio mostró que 55% (11/20) de las muestras HTLV-I seropositivas correspondieron a individuos mestizos, en contraste con 30% registrado para los individuos de etnia negra (6/20) y 15% para los caucásicos (3/20). Estos resultados demuestran la elevada frecuencia de la infección por el HTLV-I en la población mestiza del departamento de Córdoba que se incluyó en el estudio.

Epidemiológicamente se ha documentado la exclusión geográfica de la infección por HTLV-I de la del HTLV-II17,51,52. En este estudio se determinó y confirmó la presencia de HTLV-II en una muestra proveniente del municipio de Moñitos, donde también se registró la infección por HTLV-I. Este resultado muestra la cocirculación de los dos virus en dicha población del departamento de Córdoba. Es importante destacar que el único trabajo en que se describen infecciones traslapadas geográficamente de los dos virus en Colombia es el de Dueñas-Barajas et al.53 Sin embargo, también es importante destacar la alta circulación del HTLV-I a lo largo de las poblaciones que se incluyeron dentro del estudio.

Con el fin de obtener los datos iniciales sobre la epidemiología molecular del virus, se analizaron mediante RFLP en un segmento de 701 pb de la región 3’LTR cinco de los aislados del HTLV-I de este estudio. Los resultados obtenidos mostraron la circulación del subtipo cosmopolita con las variantes cosmopolita a y del africano occidental b. Los tres aislados caracterizados como africanos b correspondieron a individuos de etnia negra de la población de Moñitos. Estudios efectuados en las poblaciones del suroccidente colombiano también documentaron la existencia del subtipo cosmopolita con cuatro variantes, de las cuales las africanas se distribuyeron preferencialmente en los municipios de la costa pacífica54-56. Los resultados obtenidos en este estudio aportan evidencia a la propuesta de que una de las rutas de introducción del virus al continente suramericano ocurrió probablemente durante el tráfico de esclavos provenientes del África Ecuatorial durante la colonización.

Mediante el análisis de secuencias de nucleótidos de la región LTR efectuado en el presente trabajo, los autores postulan que tanto el subgrupo transcontinental como el subgrupo japonés, no están agrupados en relación con los demás subgrupos que conforman el HTLV-Ia lo que sugiere de nuevo un posible origen africano para estos dos subgrupos. Lo anterior es importante porque el agrupamiento de los aislados del departamento de Córdoba incluidos dentro del subgrupo japonés, permite postular que provenga indirectamente de un origen africano.

Los presentes resultados ampliaron el panorama de circulación de la infección por el virus en Colombia. En futuros trabajos se deberá profundizar mucho más los estudios epidemiológicos para estudiar factores asociados con el endemismo de la infección por el virus en estas regiones.

AGRADECIMIENTOS

El trabajo fue financiado con fondos de COLCIENCIAS en convenio con la Universidad del Valle y la Corporación Universitaria del Sinú. Los autores agradecen la asistencia técnica del señor Flavio Cerón investigador adjunto y del doctor Jesús Cabrera investigador del Laboratorio de Biología Molecular y Patogénesis, Facultad de Salud, Universidad del Valle y profesor de la Universidad del Tolima. Además, al Hospital San Jerónimo de Montería, A los estudiantes de medicina de la Corporación Universitaria del Sinú, del grupo semilla de investigación Orlando González, Hasmet González, Judi Arias, Alberto Caballero y Embert Amaya. Este trabajo se realizó cumpliendo con las normas vigentes para el nivel 2 de bioseguridad.

REFERENCIAS

  1. Poiesz BJ, Ruscetti FW, Gazdar AF, Bunn PA, Minna JD, Gallo R. Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc Natl Acad Sci USA 1980; 7: 7415-7419.
  2. Hinuma Y, Nagata K, Hanoka M. Adult T-cell leukemia: antigens in an ATL cell line and detection of antibodies to the antigen in human sera. Proc Natl Acad Sci USA 1998; 78: 6476-6480.
  3. Gessain A, Francis H, Sonan C. HTLV-I and tropical spastic paraparesis in Africa. Lancet 1986; ii: 698.
  4. Osame M, Usuku K, Izumo S, et al. HTLV-I associated myelopathy, a new clinical entity. Lancet 1986; i: 1031-1032.
  5. Arango C, Concha M, Zaninovic’ V, Borrero I. Epidemiology of tropical spastic paraparesis in Colombia and associated HTLV-I infection. Ann Neurol 1988; 23 (suppl): 161-165.
  6. Trujillo CM, Concha M, Muñoz A, et al. Seroprevalence and cofactors of HTLV-I infection in Tumaco, Colombia. AIDS Res Hum Retrovirus 1992; 8: 651-657.
  7. Osame M, Izumo S, Igata A. Blood transfusion and HTLV-I associated myelopathy. Lancet 1986; ii: 104-105.
  8. Itoyama Y, Minato S, Kira J. Altered subset of peripheral blood lymphocytes in patients with HTLV-I-associated myelopathy (HAM). Neurology 1988; 38: 816-818.
  9. Jacobson S, Zaninovic’ V, Mora C. Immunological findings in neurological diseases associated with antibodies to HTLV-I: activated lymphocytes in tropical spastic paraparesis. Ann Neurol 1988; 23 (suppl): 196-200.
  10. Osame M, Igata A. The history of discovery and clinic-epidemiology of HTLV-I-associated myelopathy (HAM). Jpn J Med 1989; 28: 412-414.
  11. Yamaguchi K. Human T limphotropic virus type I in Japan. Lancet 1994; 343: 213-222.
  12. Blattner WA, Saxinger C, Riedel D, et al. A study of HTLV-I and its associated risk factors in Trinidad and Tobago. J Acquir Immune Defic Syndr 1990; 3: 1102-1108.
  13. Murphy EL, Figueroa JP, Gibbs WN, et al. Human T-lymphotropic virus type I (HTLV-I) seroprevalence in Jamaica. I: Demographic determinants. Am J Epidemiol 1991; 133: 1114-1124.
  14. Cartier L, Araya F, Castillo JL, Ruiz F, Gormaz A, Tajima K. Progressive spastic paraparesis associated with human T-cell leukemia virus type I (HTLV-I). Intern Med 1992; 31: 1257-1261.
  15. Pombo de Oliveira MS, Tabak DG. The significance of phenotyping leukemias using monoclonal antibodies. Braz J Med Biol Res 1990; 23: 763-772.
  16. Arango C, Concha M, Zaninovic’ V, et al. Epidemiology of tropical spastic paraparesis in Colombia and associated HTLV-I infection. Ann Neurol 1988; 23 (Suppl): 161-165.
  17. Zamora T, Zaninovic’ V, Kajiwara M, Komoda H, Hayami M, Tajima K. Antibody to HTLV-I in indigenous inhabitants of the Andes and Amazon regions in Colombia. Jpn J Cancer Res 1990; 81:715-719.
  18. Verdier M, Bonis J, Leonard G, Dumas M, Denis F. HTLV-I Antibody class and subclass distribution in African TSP and control populations. J Neurol 1993; 42: 117-120.
  19. Offor E, García-Vallejo F, Essex M. HTLV-1 Infection in asymptomatic individuals in Nigeria. AIDS Res Hum Retroviruses 1994; 10: 446.
  20. Mahieux R, Ibrahim F, Mauclere P, et al. Molecular epidemiology of 58 new African human T-cell leukemia virus type I (HTLV-I) strains. Identification of a new and distintict HTLV-I molecular subtype in Central Africa in pigmies. J Virol 1997; 71: 1317-1333.
  21. Mboudjeka I, Zekeng L, Yamoshita M, et al. Prevalence and phylogenetic analysis of HTLV-I isolates in Cameroon, including those of the Baka pigmy. J Cancer Res 1997; 88: 619-624.
  22. Román GC, Spencer PS, Schoenberg BS, et al. Tropical spastic paraparesis in Seychelles Island: A clinical and case control neuroepidemiologic study. Neurology 1987; 37: 1323-1328.
  23. Nerurkar VR, Song KJ, Saitou N, Melland RR, Yanagihara R. Interfamilial and intrafamilial genomic diversity and molecular phylogeny of human T-cell lymphotopic virus type I from Papua Nueva Guinea and the Solomon Island. Virology 1993; 196: 506-513.
  24. Nerurkar VR, Miller MA, León-Monsón ME, et al. Failure to isolate human T-cell lymphoropic virus type I and to detect variant-specific genomic sequence by polimarase chain reaction in Melanesians with indeterminate Western immunoblot. J Gen Virol 1992; 73: 1805-1810.
  25. Hoshino H, Nakamura T, Tanaka Y, Miyoshi I, Yanagihara R. Functional conservation of the neutralizing domains on the external envelope glycoprotein of cosmopolitan and Melanesian extrains of human T-cell leukemia/lymphoma virus type I. J Infect Dis 1993; 168: 1368-1373.
  26. Bastian I, Gardner J, Webb D, Gardner. Isolation of a human T-lymphotropic virus type I strain from Australian aboriginals. J Virol 1993; 67: 843-851.
  27. Wang CH, Yang CS. Seroepiedemiology of human T-cell lymphotropic virus type I infection in Taiwan. Cancer Res 1988; 48: 5042-5044.
  28. Nerurkar VR, Babu PG, Song K J, et al. Sequence analysis of human T-cell lymphotropic virus type I strains from Southern India: gene amplification and direct sequencing from whole blood blotted onto filter paper. J Gen Virol 1993; 74: 2799-2802.
  29. Seyfert S, Blum S. HTLV-I associated myelopahty in China. J Neurol 1994; 241: 398-400.
  30. Dosik H, Denic S, Patel N, Krishnamurthy M, Levine PH, Clark JW. Adult T-cell leukemia/lymphoma in Brooklyn. JAMA 1988; 259: 2255-2257.
  31. Hale A, Leung T, Sivasubramaniam S, Kenny J, Sutherland S. Prevalence of antibodies to HTLV-I antenatal clinic attenders in south east London. J Med Virol 1997; 52: 326-239.
  32. Yamashita M, Picchio G, Veronesi R, Ohkura S, Bare P, Hayami M. HTLV-Is in Argentina are phylogenetically similar to those of other South American countries, but different from HTLV-Is in Africa. J Med Virol 1998; 55: 152-160.
  33. Voevodin A, Gessain A. Common origin of human T-lymphotropic virus type I from Iran, Kuwait, Israel and La Reunion Island. J Med Virol 1997; 52: 77-82.
  34. Voevodin A, Al-Mufus, Farah S, Khan R, Miura T. Molecular characterization of human T-lymphotropic virus type I (HTLV-I) found in Kuwait: close similarity with HTLV-I isolates originating from Mashhadi, Iran. AIDS Res Hum Retroviruses 1995; 11: 1255-1259.
  35. Voevodin A. Substitutions T-->C 4783 and T-->C 6569 in the pol and env genes of HTLV-I are characteristic for the isolates originating in the Middle East. Leukemia 1997; 11 (Suppl 3): 52-53.
  36. Nerurkar VR, Song KJ, Melland RR, Yanagihara R. Genetic and phylogenetic analyses of human T-cell lymphotropic virus type I variants from Melanesians with and without spastic myelopathy. Mol Neurobiol 1994; 8: 155-173.
  37. Liu H, Vandame AM, Kasad K, Carton H, Desmyter J, Goubau P. Familial transmission and minimal sequence variability of human T-lymphotropic virus type I (HTLV-I) in Zaire. AIDS Res Hum Retroviruses 1994; 10: 1135-42.
  38. Olaleye OD, Ekweozer CC, Li ZL, et al. Human T-cell lymphotropic virus types I and II infections in patients with leukemia/lymphoma and in subjects with sexually transmitted diseases in Nigeria. Arch Virol 1996; 141: 345-355.
  39. Chen, Y-MA, Okayama A, Lee T-H, Tachibana N, Mueller N, Essex M. Sexual transmission of human T-cell leukemia virus type I associated with presence of anti-tax antibody. Proc Natl Acad Sci USA 1991; 88: 1182-1186.
  40. Komurian-Pradel F, Pelloquin F, Sonoda S, Osame M, de The G. Geographic subtypes demonstrated by RFLPs following PCR in the LTR region of HTLV-I. AIDS Res Retroviruses 1992; 8: 429-434.
  41. Komurian F, Pelloquin F, De-The G. In vivo genomic variability of the human T-cell virus type I depends more upon geography upon pathologies. J Virol 1991; 65: 3770-3778.
  42. Soto L, García-Vallejo F, Renjifo B, Domínguez MC, Vergara A, Essex M. Antibodies in gingival crevicularfluid in patients with tropical spastic paraparesis-HTLV-1-associated myelopathy (TSP/HAM). Viral Immunol 1995; 8: 141-150.
  43. García-Vallejo F, Bonilla R, Gallego G, Rugeles M, Borrero I. Amplificación de segmentos de ADN del virus linfotrópico humano I (HTLV-I) en pacientes con paraparesia espástica tropical y seropositivos asintomáticos. Colombia Med 1992; 23: 50-56.
  44. Sambrook J, Fritzch EF, Maniatis T. Molecularcloning. A laboratory manual. New York: Ed. Cold Spring Harbor Press; 1989.
  45. Thompson J, Higgins D, Gibson T. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Rev 1980; 39: 783-791.
  46. Nei M. Phylogenetic analysis in molecular evolutionary genetics. Annu Rev Genet 1996; 30: 371-403.
  47. Torroni A, Huoponen K, Francalari P, et al. Classification of European mtDNAs from an analysis of three European populations. Genetics 1996; 144: 1835-1850.
  48. Dangond F, Daza JS, Rosania A, et al. Tropical spastic paraparesis on the Caribbean coast of Colombia. J Trop Med Hyg 1995; 52: 155-158.
  49. Egea E, Blank A, Garavito G, et al. Restricción étnica y geográfica de la infección por HTLV-II y su asociación con el polimorfismo del complejo mayor de histocompatibilidad en tres poblaciones del Caribe colombiano. Acta Med Colomb 1999; 24: 137-143.
  50. Navas M, Iglesias A, Martínez B, Caraballo L. Prevalencia de anticuerpos contra HTLV-I en población negra del Caribe. Biomedica 1995; 15: 34-36.
  51. Kondo T, Kono H, Miyamoto N, et al. Age- and sex-specific cumulative rate and risk of ATLL for HTLV-I carriers. Int J Cancer 1989; 43: 1061-1064.
  52. Zaninovic’ V, Sazón Y, López F, et al. Geographic indepedence of HTLV-I and HTLV-II foci in the Andes Highland, the Atlantic Coast and the Orinoco of Colombia. AIDS Res Hum Retroviruses 1994; 10: 97-101.
  53. Dueñas-Barajas E, Bernal JE, Vaught DR, et al. Coexistence of human T-cell lymphotropic virus type I and II among Wayuu indians from the Guajira region of Colombia. AIDS Res Hum Retroviruses 1992; 8: 1851-1855.
  54. García-Vallejo F, Chávez M, Domínguez MC, Blank A. Microagregación genética y geográfica de aislados del virus linfotrópico humano Tipo I (HTLV-I) en zonas endémicas del suroccidente de Colombia. Colomb Med 2000; 31: 110-117.
  55. Domínguez MC, Castillo A, Cabrera J, Eizuru Y, Akiba S, García-Vallejo F. Envelope sequence variation and phylogenetic relations of human T-cell lymphotropic virus (HTLV) type I from endemic areas of Colombia. AIDS Res Hum Retroviruses 2002; 18: 887-890.
  56. Balcázar N, Sánchez G, García-Vallejo F. Sequence and phylogenetic analysis of Human T-lymphotropic virus type 1 from Tumaco, Colombia. Mem Inst Oswaldo Cruz 2003; 98: 641-648.

Copyright 2004 - Revista Colombia Médica


The following images related to this document are available:

Photo images

[rc04005t3.jpg] [rc04005g3.jpg] [rc04005g2.jpg] [rc04005t2.jpg] [rc04005g4.jpg] [rc04005g1a.jpg] [rc04005g1b.jpg] [rc04005t1.jpg]
Home Faq Resources Email Bioline
© Bioline International, 1989 - 2019, Site last up-dated on 02-May-2019.
Site created and maintained by the Reference Center on Environmental Information, CRIA, Brazil
System hosted by the Internet Data Center of Rede Nacional de Ensino e Pesquisa, RNP, Brazil